Transcript: Human XR_002958231.1

PREDICTED: Homo sapiens thyroid hormone receptor associated protein 3 (THRAP3), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
THRAP3 (9967)
Length:
4608
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002958231.1
NBCI Gene record:
THRAP3 (9967)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002958231.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276344 GGCTATAGAAGGCCCTATTAT pLKO_005 446 3UTR 100% 15.000 21.000 N THRAP3 n/a
2 TRCN0000276343 AGTATATCAGAATCGGGATTT pLKO_005 409 3UTR 100% 10.800 15.120 N THRAP3 n/a
3 TRCN0000022111 GCAGCCTATACAAAGAGGTAT pLKO.1 1235 3UTR 100% 4.950 6.930 N THRAP3 n/a
4 TRCN0000022113 CGAGAAGAGAAGGACAATATA pLKO.1 3230 3UTR 100% 15.000 10.500 N THRAP3 n/a
5 TRCN0000276379 TGGAGCTAAGATGACTAATTT pLKO_005 3628 3UTR 100% 15.000 10.500 N THRAP3 n/a
6 TRCN0000276342 AGATCTCGTTCTCGTTCATTT pLKO_005 272 3UTR 100% 13.200 9.240 N THRAP3 n/a
7 TRCN0000022110 CCGCTCAAATTGGCAGAATTA pLKO.1 532 3UTR 100% 13.200 9.240 N THRAP3 n/a
8 TRCN0000375369 TCATATTCTCCAGCTCATAAC pLKO_005 368 3UTR 100% 10.800 7.560 N Thrap3 n/a
9 TRCN0000022109 GCCCAACATATAGTGACCATT pLKO.1 2093 3UTR 100% 4.950 3.465 N THRAP3 n/a
10 TRCN0000022112 GCCTTGATATTGAACGTCGTA pLKO.1 2556 3UTR 100% 2.640 1.848 N THRAP3 n/a
11 TRCN0000285546 GCCTTGATATTGAACGTCGTA pLKO_005 2556 3UTR 100% 2.640 1.848 N THRAP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002958231.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02278 pDONR223 100% 62% None (many diffs) n/a
2 ccsbBroad304_02278 pLX_304 0% 62% V5 (many diffs) n/a
3 TRCN0000467356 ACATGAGGTCCACGCCAACTTGTC pLX_317 12.9% 62% V5 (many diffs) n/a
Download CSV