Transcript: Human XR_002958480.1

PREDICTED: Homo sapiens transmembrane protein 230 (TMEM230), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM230 (29058)
Length:
2285
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002958480.1
NBCI Gene record:
TMEM230 (29058)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002958480.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000275146 CCCTCCTAAGATCCCTTATAA pLKO_005 253 3UTR 100% 15.000 10.500 N TMEM230 n/a
2 TRCN0000131231 GACGATGGCTACATTGACCTT pLKO.1 218 3UTR 100% 2.640 1.848 N TMEM230 n/a
3 TRCN0000275096 GACGATGGCTACATTGACCTT pLKO_005 218 3UTR 100% 2.640 1.848 N TMEM230 n/a
4 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 741 3UTR 100% 4.950 2.475 Y CFLAR n/a
5 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 741 3UTR 100% 4.950 2.475 Y C19orf31 n/a
6 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2231 3UTR 100% 5.625 2.813 Y KLHL30 n/a
7 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 739 3UTR 100% 4.950 2.475 Y ERN2 n/a
8 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 739 3UTR 100% 4.950 2.475 Y P3H4 n/a
9 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 739 3UTR 100% 4.950 2.475 Y P3H4 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2231 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002958480.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03066 pDONR223 100% 14.6% None (many diffs) n/a
2 ccsbBroadEn_15802 pDONR223 0% 14.5% None (many diffs) n/a
3 ccsbBroad304_15802 pLX_304 0% 14.5% V5 (many diffs) n/a
4 TRCN0000474148 ACACACTCTCCGAGCACACATGGC pLX_317 100% 14.5% V5 (many diffs) n/a
5 ccsbBroadEn_08101 pDONR223 100% 14.3% None (many diffs) n/a
6 ccsbBroad304_08101 pLX_304 0% 14.3% V5 (many diffs) n/a
7 TRCN0000468750 GCGGACCAATCTGGGAATACGTAT pLX_317 100% 14.3% V5 (many diffs) n/a
Download CSV