Transcript: Mouse XR_140685.5

PREDICTED: Mus musculus predicted gene 13237 (Gm13237), misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm13237 (666390)
Length:
1047
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_140685.5
NBCI Gene record:
Gm13237 (666390)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_140685.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000092928 GCTACAACTACAGTTAGATTT pLKO.1 954 3UTR 100% 13.200 6.600 Y Gm13237 n/a
2 TRCN0000304269 AGAGCGACAAAGCTCGTTATG pLKO_005 338 3UTR 100% 10.800 5.400 Y Hmgb2 n/a
3 TRCN0000304268 TTGGAGATACTGCGAAGAAAC pLKO_005 509 3UTR 100% 10.800 5.400 Y Hmgb2 n/a
4 TRCN0000092931 CAACCGTATGAGCAGAAAGTA pLKO.1 568 3UTR 100% 5.625 2.813 Y Gm13237 n/a
5 TRCN0000092880 CTGAGCAATCTGCCAAAGATA pLKO.1 545 3UTR 100% 5.625 2.813 Y Gm4169 n/a
6 TRCN0000092879 GACAGGGAGATGAAGAACTAT pLKO.1 358 3UTR 100% 5.625 2.813 Y Gm4169 n/a
7 TRCN0000075585 GCTAAACTAAAGGAGAAGTAT pLKO.1 589 3UTR 100% 5.625 2.813 Y Hmgb2 n/a
8 TRCN0000310863 TAGGCCAACAGGCTCAAAGAA pLKO_005 672 3UTR 100% 5.625 2.813 Y Hmgb2 n/a
9 TRCN0000092882 CAAGAGCGACAAAGCTCGTTA pLKO.1 336 3UTR 100% 4.950 2.475 Y Gm4169 n/a
10 TRCN0000092941 CAGGCCTGTCTATTGGAGATA pLKO.1 497 3UTR 100% 4.950 2.475 Y Gm13232 n/a
11 TRCN0000075586 CCAAGAAATGCTCCGAGAGAT pLKO.1 269 3UTR 100% 4.950 2.475 Y Hmgb2 n/a
12 TRCN0000092930 CCGTCTGCCTTCTTCCTGTTT pLKO.1 439 3UTR 100% 4.950 2.475 Y Gm13237 n/a
13 TRCN0000092942 GAAGATGAGGAGGAGGAAGAA pLKO.1 706 3UTR 100% 4.950 2.475 Y Gm13232 n/a
14 TRCN0000075587 GAGGAAGAAGAGGAGGATGAA pLKO.1 751 3UTR 100% 4.950 2.475 Y Hmgb2 n/a
15 TRCN0000173568 GAGGAAGAAGAGGAGGATGAA pLKO.1 751 3UTR 100% 4.950 2.475 Y Chic1 n/a
16 TRCN0000301335 GAGGAAGAAGAGGAGGATGAA pLKO_005 751 3UTR 100% 4.950 2.475 Y Hmgb2 n/a
17 TRCN0000092929 GAGGAAGATGAAGAGGAAGAA pLKO.1 739 3UTR 100% 4.950 2.475 Y Gm13237 n/a
18 TRCN0000092938 GATGAGATTCTTTGTAGAGAA pLKO.1 897 3UTR 100% 4.950 2.475 Y Gm13232 n/a
19 TRCN0000092932 GCCAACAGGCTCAAAGAAGAA pLKO.1 675 3UTR 100% 4.950 2.475 Y Gm13237 n/a
20 TRCN0000075583 GCTCAACATTAGCTTCAGTAT pLKO.1 849 3UTR 100% 4.950 2.475 Y Hmgb2 n/a
21 TRCN0000301407 GCTCAACATTAGCTTCAGTAT pLKO_005 849 3UTR 100% 4.950 2.475 Y Hmgb2 n/a
22 TRCN0000413410 AGGAGGAAGATGAAGAGGAAG pLKO_005 737 3UTR 100% 4.050 2.025 Y Myt1 n/a
23 TRCN0000075584 GCCAAAGATAAACAACCGTAT pLKO.1 556 3UTR 100% 4.050 2.025 Y Hmgb2 n/a
24 TRCN0000092878 GCTGTCCTAAAGTGTGGAGTA pLKO.1 781 3UTR 100% 4.050 2.025 Y Gm4169 n/a
25 TRCN0000092940 GAAGAACTATGTTCCTCCCAA pLKO.1 369 3UTR 100% 2.640 1.320 Y Gm13232 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_140685.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00751 pDONR223 100% 53.8% None (many diffs) n/a
2 ccsbBroad304_00751 pLX_304 0% 53.8% V5 (many diffs) n/a
3 TRCN0000472051 TCGTGCCCACAAAACATGTAAAGT pLX_317 56.4% 53.8% V5 (many diffs) n/a
Download CSV