Transcript: Human XR_243632.1

PREDICTED: Homo sapiens transmembrane channel like 6 (TMC6), transcript variant X9, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMC6 (11322)
Length:
2702
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_243632.1
NBCI Gene record:
TMC6 (11322)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_243632.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415542 GAACTGGTGTGGAGGATTATC pLKO_005 1890 3UTR 100% 13.200 10.560 N TMC6 n/a
2 TRCN0000119004 TCACTCCATCTACGAGAGGAA pLKO.1 2367 3UTR 100% 2.640 2.112 N TMC6 n/a
3 TRCN0000436891 CGCCTCCAGCAGGACAATATT pLKO_005 1380 3UTR 100% 15.000 10.500 N TMC6 n/a
4 TRCN0000414254 ATGTCCTGGAGCTGATTTATG pLKO_005 1963 3UTR 100% 13.200 9.240 N TMC6 n/a
5 TRCN0000119002 CCAGGACAAGGAAGACAGTTT pLKO.1 2551 3UTR 100% 4.950 3.465 N TMC6 n/a
6 TRCN0000119003 CGTCATGTACTACGGCCACTA pLKO.1 1097 3UTR 100% 4.050 2.835 N TMC6 n/a
7 TRCN0000119005 GAGCTTCTTTATCACCTGCAT pLKO.1 1235 3UTR 100% 2.640 1.848 N TMC6 n/a
8 TRCN0000119006 CTGCTCACAGATGAACAGGAT pLKO.1 2446 3UTR 100% 2.640 1.584 N TMC6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_243632.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11621 pDONR223 100% 42.2% None 1_1271del;2075_2076ins134;2470_2702del n/a
2 ccsbBroad304_11621 pLX_304 0% 42.2% V5 1_1271del;2075_2076ins134;2470_2702del n/a
3 TRCN0000467470 GATCCCGCGACTGGTCAGGGAGGG pLX_317 28.5% 42.2% V5 1_1271del;2075_2076ins134;2470_2702del n/a
4 ccsbBroadEn_11622 pDONR223 100% 23.4% None 1_1271del;1905_2702del n/a
5 ccsbBroad304_11622 pLX_304 0% 23.4% V5 1_1271del;1905_2702del n/a
6 TRCN0000481404 AAGCACCGAATTTTGCACCAGTCC pLX_317 36.7% 23.4% V5 1_1271del;1905_2702del n/a
Download CSV