Transcript: Mouse XR_374547.3

PREDICTED: Mus musculus N-acetyltransferase 10 (Nat10), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nat10 (98956)
Length:
5551
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_374547.3
NBCI Gene record:
Nat10 (98956)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_374547.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000444703 ATAACCTCCACACGCTGTTTG pLKO_005 2556 3UTR 100% 10.800 15.120 N Nat10 n/a
2 TRCN0000446016 TCTCGGAACATGGTCGATTAC pLKO_005 4039 3UTR 100% 10.800 15.120 N Nat10 n/a
3 TRCN0000184712 CCTCCAAGAGTCAATCCGATA pLKO.1 2946 3UTR 100% 4.050 3.240 N Nat10 n/a
4 TRCN0000296411 TTGCTGTTCACCCAGATTATC pLKO_005 3440 3UTR 100% 13.200 9.240 N NAT10 n/a
5 TRCN0000425541 ACCCAGGTCAGTCTCACTTTG pLKO_005 5205 3UTR 100% 10.800 7.560 N Nat10 n/a
6 TRCN0000432460 GTATCAGGAGCATCTGGATTA pLKO_005 2608 3UTR 100% 10.800 7.560 N Nat10 n/a
7 TRCN0000179570 GAAGACAAAGTCACTCTTGAA pLKO.1 5126 3UTR 100% 4.950 3.465 N Nat10 n/a
8 TRCN0000184285 GCACCATCGTTCCATCTGTAT pLKO.1 5092 3UTR 100% 4.950 3.465 N Nat10 n/a
9 TRCN0000180802 GCTGGATTTGTTCCTGTCTAT pLKO.1 3730 3UTR 100% 4.950 3.465 N Nat10 n/a
10 TRCN0000414401 AGAGTGGGACCTTGAACTTAA pLKO_005 1848 3UTR 100% 13.200 7.920 N Nat10 n/a
11 TRCN0000184551 GCAGTGGAGAAGTGGCTTAAT pLKO.1 2980 3UTR 100% 13.200 7.920 N Nat10 n/a
12 TRCN0000035700 CGAGCTGGATTTGTTCCTGTT pLKO.1 3727 3UTR 100% 4.050 2.835 N NAT10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_374547.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489299 TGTGGATGATTATCAGCCCCGTGT pLX_317 12.7% 47.8% V5 (many diffs) n/a
2 ccsbBroadEn_03554 pDONR223 100% 47.8% None (many diffs) n/a
3 ccsbBroad304_03554 pLX_304 0% 47.8% V5 (many diffs) n/a
4 TRCN0000467973 GCACGAATCGTCGTTATCGTATGG pLX_317 12.6% 47.8% V5 (many diffs) n/a
5 TRCN0000489921 GGAAGCGGACCGCAAGTAAAATCC pLX_317 15.2% 47.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV