Transcript: Mouse XR_378214.2

PREDICTED: Mus musculus eukaryotic elongation factor-2 kinase (Eef2k), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Eef2k (13631)
Length:
1676
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_378214.2
NBCI Gene record:
Eef2k (13631)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_378214.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000368708 TGATGACAACATCCGACTAAC pLKO_005 1086 3UTR 100% 10.800 15.120 N Eef2k n/a
2 TRCN0000321868 CCAAAGTCCAGAGCTACTATA pLKO_005 509 3UTR 100% 13.200 10.560 N Eef2k n/a
3 TRCN0000219747 CTCATGCCTGCAACCGGATTT pLKO.1 1277 3UTR 100% 10.800 8.640 N EEF2K n/a
4 TRCN0000234844 CTCATGCCTGCAACCGGATTT pLKO_005 1277 3UTR 100% 10.800 8.640 N EEF2K n/a
5 TRCN0000321869 TGACGATGATGAGGGCTATTT pLKO_005 441 3UTR 100% 13.200 9.240 N Eef2k n/a
6 TRCN0000023819 GCTCTCTTCTTCTACTCTCAT pLKO.1 1261 3UTR 100% 4.950 3.465 N Eef2k n/a
7 TRCN0000321802 GCTCTCTTCTTCTACTCTCAT pLKO_005 1261 3UTR 100% 4.950 3.465 N Eef2k n/a
8 TRCN0000023820 CGTGATGACAACATCCGACTA pLKO.1 1084 3UTR 100% 4.050 2.835 N Eef2k n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_378214.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492335 CGCCGGACCCGCAATACTGAATTT pLX_317 2.3% 45.3% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489259 GACGTCGGACGCCTGTTGGGGTAA pLX_317 14% 45.3% V5 (many diffs) n/a
3 ccsbBroadEn_08135 pDONR223 100% 45.3% None (many diffs) n/a
4 ccsbBroad304_08135 pLX_304 0% 45.3% V5 (many diffs) n/a
5 TRCN0000472529 GGCTCGCTACGTGCTCCCGAATGA pLX_317 14.1% 45.3% V5 (many diffs) n/a
6 ccsbBroadEn_15051 pDONR223 0% 45.3% None (many diffs) n/a
7 ccsbBroad304_15051 pLX_304 0% 45.3% V5 (many diffs) n/a
8 TRCN0000492104 GTTATTGCCATCTCCAACGAGCAA pLX_317 11.7% 45.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV