Transcript: Mouse XR_380393.2

PREDICTED: Mus musculus RIC8 guanine nucleotide exchange factor B (Ric8b), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ric8b (237422)
Length:
2311
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_380393.2
NBCI Gene record:
Ric8b (237422)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_380393.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000440998 ACCGAAGAGCTGCACAGTAAT pLKO_005 1313 3UTR 100% 13.200 18.480 N Ric8b n/a
2 TRCN0000445620 CACGAGTCAGACGATTCTTTG pLKO_005 788 3UTR 100% 10.800 15.120 N Ric8b n/a
3 TRCN0000006465 CGACAAGCATAGGGCTACTTT pLKO.1 571 3UTR 100% 5.625 7.875 N RIC8B n/a
4 TRCN0000418668 ACTTGTCAACATGCTTGATAA pLKO_005 2035 3UTR 100% 13.200 9.240 N Ric8b n/a
5 TRCN0000192421 CCTTCGCCATTGTTTACTAAT pLKO.1 1270 3UTR 100% 13.200 9.240 N Ric8b n/a
6 TRCN0000414912 GTCGGCTCAACCGTGAGAAAT pLKO_005 1694 3UTR 100% 13.200 9.240 N Ric8b n/a
7 TRCN0000200949 CCCAGTTATTGTGGAATCATT pLKO.1 826 3UTR 100% 5.625 3.938 N Ric8b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_380393.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12180 pDONR223 100% 60.6% None (many diffs) n/a
2 ccsbBroad304_12180 pLX_304 0% 60.6% V5 (many diffs) n/a
3 TRCN0000477167 ACGTCCTACCCTAAGCCCTGGAGT pLX_317 19.1% 60.6% V5 (many diffs) n/a
Download CSV