Transcript: Mouse XR_386522.1

PREDICTED: Mus musculus transmembrane protein 180 (Tmem180), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mfsd13a (75146)
Length:
2111
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_386522.1
NBCI Gene record:
Mfsd13a (75146)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_386522.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248485 ATTTGGTGGGCTCGGGAGTTT pLKO_005 1874 3UTR 100% 4.950 3.960 N Mfsd13a n/a
2 TRCN0000215683 GATCCATACTCTGAACATTAA pLKO.1 1541 3UTR 100% 13.200 9.240 N Mfsd13a n/a
3 TRCN0000247797 GATCCATACTCTGAACATTAA pLKO_005 1541 3UTR 100% 13.200 9.240 N Mfsd13a n/a
4 TRCN0000248486 TCTCAGTGTATAAGATCAATA pLKO_005 308 3UTR 100% 13.200 9.240 N Mfsd13a n/a
5 TRCN0000257806 TGGGTTGGAGAGACTGTATTT pLKO_005 340 3UTR 100% 13.200 9.240 N Mfsd13a n/a
6 TRCN0000184594 GCTTTCTGGGAACCACACAAT pLKO.1 800 3UTR 100% 4.950 3.465 N Mfsd13a n/a
7 TRCN0000248487 TCTGGGAACCACACAATTATT pLKO_005 804 3UTR 100% 15.000 9.000 N Mfsd13a n/a
8 TRCN0000184400 CATGTGACTCAGCTTGTGCAA pLKO.1 1730 3UTR 100% 2.640 1.584 N Mfsd13a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_386522.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08968 pDONR223 100% 52.4% None (many diffs) n/a
2 ccsbBroad304_08968 pLX_304 0% 52.4% V5 (many diffs) n/a
3 TRCN0000475486 ACCACTAATACATCGGAACCCTTT pLX_317 19.1% 52.4% V5 (many diffs) n/a
4 ccsbBroadEn_12632 pDONR223 100% 21.8% None (many diffs) n/a
5 ccsbBroad304_12632 pLX_304 0% 21.8% V5 (many diffs) n/a
6 TRCN0000478750 AGGCGAGTGGAGCTCAATCTTCAT pLX_317 60% 21.8% V5 (many diffs) n/a
Download CSV