Transcript: Mouse XR_388490.3

PREDICTED: Mus musculus misshapen-like kinase 1 (zebrafish) (Mink1), transcript variant X8, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mink1 (50932)
Length:
5327
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_388490.3
NBCI Gene record:
Mink1 (50932)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_388490.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361713 AGGAACAAACTGCGGGTATAT pLKO_005 3776 3UTR 100% 13.200 18.480 N Mink1 n/a
2 TRCN0000361638 TGTGAAATATGAACGGATTAA pLKO_005 3904 3UTR 100% 13.200 18.480 N Mink1 n/a
3 TRCN0000025334 CGGATTAAGTTCCTGGTCATT pLKO.1 3917 3UTR 100% 4.950 6.930 N Mink1 n/a
4 TRCN0000196775 GAACCGTAACTGCATCATGAA pLKO.1 4532 3UTR 100% 4.950 6.930 N MINK1 n/a
5 TRCN0000025338 CCATCGCAATATTGCCACCTA pLKO.1 649 3UTR 100% 2.640 3.696 N Mink1 n/a
6 TRCN0000361640 GCTGGGAACGTGACCTCATAT pLKO_005 4686 3UTR 100% 13.200 10.560 N Mink1 n/a
7 TRCN0000025336 CGACCTGGTAAAGAACACAAA pLKO.1 757 3UTR 100% 4.950 3.960 N Mink1 n/a
8 TRCN0000284870 AGCGGCTCAAGGTCATCTATG pLKO_005 4065 3UTR 100% 10.800 7.560 N MINK1 n/a
9 TRCN0000025335 CCCAGGCTCAAGTCAAAGAAA pLKO.1 1166 3UTR 100% 5.625 3.938 N Mink1 n/a
10 TRCN0000025337 GCTTGCTGATAGCAATGGCTA pLKO.1 3238 3UTR 100% 2.640 1.848 N Mink1 n/a
11 TRCN0000361720 CCACCGAACAGTTACTCAAAT pLKO_005 1251 3UTR 100% 13.200 7.920 N Mink1 n/a
12 TRCN0000195612 CTTTCGTGATCACGTGACCAT pLKO.1 4715 3UTR 100% 2.640 1.848 N MINK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_388490.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15055 pDONR223 39.3% 68.2% None (many diffs) n/a
2 ccsbBroad304_15055 pLX_304 0% 68.2% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000469341 TGTTGAACGGGAACAATCATACGG pLX_317 9% 68.2% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000488183 AGTGTCCGTCGATCTTTACTTGCG pLX_317 8.9% 67.2% V5 (many diffs) n/a
5 TRCN0000488128 GTACACACAATACATGCGTTGTTC pLX_317 8.9% 67% V5 (many diffs) n/a
6 TRCN0000487725 GTTAGATCCCATAGCCACAACTTC pLX_317 1% 67.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV