Transcript: Mouse XR_391340.3

PREDICTED: Mus musculus leucine-rich repeat kinase 1 (Lrrk1), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lrrk1 (233328)
Length:
5377
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_391340.3
NBCI Gene record:
Lrrk1 (233328)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_391340.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000088829 GCCCTCATGTTCTTGAGGTTA pLKO.1 1598 3UTR 100% 0.495 0.693 N Lrrk1 n/a
2 TRCN0000362121 GAACCGGAAAGTCACTATTTA pLKO_005 3346 3UTR 100% 15.000 12.000 N Lrrk1 n/a
3 TRCN0000362197 ACATTCCGAGTCCGAAGAAAT pLKO_005 3401 3UTR 100% 13.200 10.560 N Lrrk1 n/a
4 TRCN0000362202 AGAGCTCCCTGTCCAATTTAT pLKO_005 1357 3UTR 100% 15.000 10.500 N Lrrk1 n/a
5 TRCN0000362199 GCAGACGCCTGGCAATGATAT pLKO_005 2818 3UTR 100% 13.200 9.240 N Lrrk1 n/a
6 TRCN0000362198 TAAGGGTATGTGCCCATTAAG pLKO_005 4998 3UTR 100% 13.200 9.240 N Lrrk1 n/a
7 TRCN0000088831 AGCCTATTTCTGCTCCTACAT pLKO.1 829 3UTR 100% 4.950 3.465 N Lrrk1 n/a
8 TRCN0000088830 CAAGGAGCATATCAACATCAA pLKO.1 4375 3UTR 100% 4.950 2.970 N Lrrk1 n/a
9 TRCN0000088832 GCCATGAAGAACTTCTCAGAT pLKO.1 4067 3UTR 100% 4.950 2.970 N Lrrk1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_391340.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489245 CTGCCTTATAAACTAAGGTCTGGC pLX_317 7.1% 43.2% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489672 GCTATGCTTATTTCGCATCCGCTT pLX_317 8% 43.2% V5 (many diffs) n/a
Download CSV