Transcript: Human XR_428728.2

PREDICTED: Homo sapiens BMS1 ribosome biogenesis factor (BMS1), transcript variant X7, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BMS1 (9790)
Length:
2873
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_428728.2
NBCI Gene record:
BMS1 (9790)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_428728.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148955 GAAGGGCATTTCAGGATCAAA pLKO.1 1691 3UTR 100% 5.625 3.938 N BMS1 n/a
2 TRCN0000297473 GAAGGGCATTTCAGGATCAAA pLKO_005 1691 3UTR 100% 5.625 3.938 N BMS1 n/a
3 TRCN0000129473 GCATTTGCTGACAGTGACGAT pLKO.1 1587 3UTR 100% 2.640 1.848 N BMS1 n/a
4 TRCN0000278476 GCATTTGCTGACAGTGACGAT pLKO_005 1587 3UTR 100% 2.640 1.848 N BMS1 n/a
5 TRCN0000149290 GCGCTGTTTAAATGAGAAGGA pLKO.1 1064 3UTR 100% 2.640 1.848 N BMS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_428728.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07487 pDONR223 100% 68.9% None (many diffs) n/a
2 ccsbBroad304_07487 pLX_304 0% 68.9% V5 (many diffs) n/a
3 TRCN0000480950 GACCCCTCCATCATAGCGCCCGAA pLX_317 10.1% 68.9% V5 (many diffs) n/a
4 ccsbBroadEn_10370 pDONR223 100% 9.5% None (many diffs) n/a
5 ccsbBroad304_10370 pLX_304 0% 9.5% V5 (many diffs) n/a
6 TRCN0000467881 ATCACAGGCGGCGTAGCCGACCCG pLX_317 71.9% 9.5% V5 (many diffs) n/a
Download CSV