Transcript: Mouse XR_865812.3

PREDICTED: Mus musculus integrator complex subunit 7 (Ints7), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Ints7 (77065)
Length:
5138
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_865812.3
NBCI Gene record:
Ints7 (77065)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_865812.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000376702 GGACGCTAATTCCGCTCTTAT pLKO_005 378 3UTR 100% 13.200 18.480 N Ints7 n/a
2 TRCN0000374923 GTTGTTCAGCACGGATCTAAA pLKO_005 3525 3UTR 100% 13.200 18.480 N Ints7 n/a
3 TRCN0000374986 AGTCGCTTAACCGGAAGTATG pLKO_005 3304 3UTR 100% 10.800 15.120 N Ints7 n/a
4 TRCN0000374924 AGTCTTCCGCATGTGCATTAA pLKO_005 3980 3UTR 100% 13.200 9.240 N Ints7 n/a
5 TRCN0000376701 GGAGTGAGAGTGCTAACTAAT pLKO_005 1405 3UTR 100% 13.200 9.240 N Ints7 n/a
6 TRCN0000181484 CCAGCTAGAAAGGTTGGAAAT pLKO.1 4665 3UTR 100% 10.800 7.560 N Ints7 n/a
7 TRCN0000176649 CAGAACTACTATGTTTGTCAA pLKO.1 3791 3UTR 100% 4.950 3.465 N Ints7 n/a
8 TRCN0000176990 GATTCCCATGATAATGTAGAA pLKO.1 760 3UTR 100% 4.950 3.465 N Ints7 n/a
9 TRCN0000181672 GTTCTCAGTGATCCACAGTAA pLKO.1 639 3UTR 100% 4.950 3.465 N Ints7 n/a
10 TRCN0000150786 GCATTCCTAAAGTTAGCTGAT pLKO.1 508 3UTR 100% 4.050 2.835 N INTS7 n/a
11 TRCN0000366286 GATCTTCTGATTTAGTCAAAT pLKO_005 1337 3UTR 100% 13.200 7.920 N Ints7 n/a
12 TRCN0000429073 GATCTTCTGATTTAGTCAAAT pLKO_005 1337 3UTR 100% 13.200 7.920 N INTS7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_865812.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07959 pDONR223 99.6% 48.5% None (many diffs) n/a
2 ccsbBroad304_07959 pLX_304 0% 48.5% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_15774 pDONR223 0% 47.8% None (many diffs) n/a
4 ccsbBroad304_15774 pLX_304 0% 47.8% V5 (many diffs) n/a
5 TRCN0000465262 GATGGAACCCTTTCTCTATATGGT pLX_317 9.6% 47.8% V5 (many diffs) n/a
Download CSV