Transcript: Mouse XR_867890.1

PREDICTED: Mus musculus splicing factor proline/glutamine rich (polypyrimidine tract binding protein associated) (Sfpq), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sfpq (71514)
Length:
9016
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_867890.1
NBCI Gene record:
Sfpq (71514)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_867890.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001082 GCCCAGAAGAATCCAATGTAT pLKO.1 2223 3UTR 100% 5.625 4.500 N SFPQ n/a
2 TRCN0000349629 GCCCAGAAGAATCCAATGTAT pLKO_005 2223 3UTR 100% 5.625 4.500 N SFPQ n/a
3 TRCN0000102243 CCAGGAAGAATTAAGGCGCAT pLKO.1 2459 3UTR 100% 2.160 1.728 N Sfpq n/a
4 TRCN0000102240 CCACTTAAATTCTTGGCATTT pLKO.1 3007 3UTR 100% 10.800 7.560 N Sfpq n/a
5 TRCN0000102242 GCCAGTTTGGTCCTATTGAAA pLKO.1 2008 3UTR 100% 5.625 3.938 N Sfpq n/a
6 TRCN0000102241 CCAGTCATTGTGGAACCACTT pLKO.1 2163 3UTR 100% 4.050 2.835 N Sfpq n/a
7 TRCN0000102244 AGAAGAAAGTTACAGCAGGAT pLKO.1 2612 3UTR 100% 2.640 1.584 N Sfpq n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_867890.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06934 pDONR223 100% 20.6% None (many diffs) n/a
2 ccsbBroad304_06934 pLX_304 0% 20.6% V5 (many diffs) n/a
3 TRCN0000476555 ATCAGGAGGGATTTCTCCAGACCT pLX_317 17.1% 20.6% V5 (many diffs) n/a
Download CSV