Transcript: Human XR_921764.3

PREDICTED: Homo sapiens ABL proto-oncogene 2, non-receptor tyrosine kinase (ABL2), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ABL2 (27)
Length:
2298
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_921764.3
NBCI Gene record:
ABL2 (27)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_921764.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002029 CCAGGCACTAAATGAGGCTAT pLKO.1 542 3UTR 100% 4.050 5.670 N ABL2 n/a
2 TRCN0000002031 GCGAACAGATATTACCATGAA pLKO.1 1136 3UTR 100% 4.950 3.960 N ABL2 n/a
3 TRCN0000002030 CCTCGTCATCTGTTGTTCCAT pLKO.1 2237 3UTR 100% 3.000 2.400 N ABL2 n/a
4 TRCN0000195370 CCTATGGAATGTCACCATATC pLKO.1 1723 3UTR 100% 1.080 0.864 N ABL2 n/a
5 TRCN0000230770 ATACATGCCATACGGGAATTT pLKO_005 1370 3UTR 100% 13.200 9.240 N ABL2 n/a
6 TRCN0000195032 CCCTAAGGTTTATGAACTTAT pLKO.1 1817 3UTR 100% 13.200 9.240 N ABL2 n/a
7 TRCN0000199920 GATGGGCTGGTGACAACATTA pLKO.1 1041 3UTR 100% 13.200 9.240 N ABL2 n/a
8 TRCN0000199548 CCACTGAGAGTGACCCTAATC pLKO.1 595 3UTR 100% 10.800 7.560 N ABL2 n/a
9 TRCN0000002032 CGGTCAGTATGGAGAGGTTTA pLKO.1 1172 3UTR 100% 10.800 7.560 N ABL2 n/a
10 TRCN0000199757 GTTCCATGACTCCAGCATTTC pLKO.1 1910 3UTR 100% 10.800 7.560 N ABL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_921764.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489907 GGCAATTTCACTGAGGTCCCTCAT pLX_317 11.6% 47.3% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000471114 CACTAGGCCAACTGCGTGAGATAA pLX_317 10.1% 45.2% V5 (many diffs) n/a
3 ccsbBroadEn_14526 pDONR223 0% 45.2% None (many diffs) n/a
4 ccsbBroad304_14526 pLX_304 0% 45.2% V5 (many diffs) n/a
Download CSV