Transcript: Human XR_944315.3

PREDICTED: Homo sapiens Rho GTPase activating protein 26 (ARHGAP26), transcript variant X11, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARHGAP26 (23092)
Length:
9298
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_944315.3
NBCI Gene record:
ARHGAP26 (23092)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_944315.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434204 ATGAACGGATACGGATGATTG pLKO_005 399 3UTR 100% 10.800 15.120 N ARHGAP26 n/a
2 TRCN0000029754 CCTGTCTACAACTCGAACAAA pLKO.1 1208 3UTR 100% 5.625 7.875 N ARHGAP26 n/a
3 TRCN0000029755 CCCTGAGAATTACGTGGAGTT pLKO.1 2710 3UTR 100% 4.050 5.670 N ARHGAP26 n/a
4 TRCN0000434831 CACTCATGATGTACCAGTTTC pLKO_005 1491 3UTR 100% 10.800 7.560 N ARHGAP26 n/a
5 TRCN0000029758 GCTTCAGCATAATCAGGAAAT pLKO.1 1269 3UTR 100% 10.800 7.560 N ARHGAP26 n/a
6 TRCN0000094893 CCAGTTTCAAAGAAGTTTCAT pLKO.1 1504 3UTR 100% 5.625 3.938 N Arhgap26 n/a
7 TRCN0000029756 CGGCAGCATTTCTATGAAGTA pLKO.1 614 3UTR 100% 4.950 3.465 N ARHGAP26 n/a
8 TRCN0000029757 GCTGAACATGACTCAGAACTT pLKO.1 2597 3UTR 100% 4.950 3.465 N ARHGAP26 n/a
9 TRCN0000084008 CGCCTATAATCCCAGCACTTT pLKO.1 6510 3UTR 100% 4.950 2.475 Y NPHS1 n/a
10 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 5700 3UTR 100% 4.950 2.475 Y LOC387873 n/a
11 TRCN0000138140 GATTGAGACCATCCTGGCTAA pLKO.1 6565 3UTR 100% 4.050 2.025 Y LOC441087 n/a
12 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 5603 3UTR 100% 2.640 1.320 Y LINC01098 n/a
13 TRCN0000130146 CAGGTTCAAGTGATTCTCCTA pLKO.1 5571 3UTR 100% 2.640 1.320 Y DICER1-AS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_944315.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07836 pDONR223 100% 23.7% None (many diffs) n/a
2 ccsbBroad304_07836 pLX_304 0% 23.7% V5 (many diffs) n/a
3 TRCN0000469771 TCTGGCCGAGTACCGTGCCCTATT pLX_317 18.1% 23.7% V5 (many diffs) n/a
4 ccsbBroadEn_13797 pDONR223 100% 1.9% None (many diffs) n/a
5 ccsbBroad304_13797 pLX_304 0% 1.9% V5 (many diffs) n/a
6 TRCN0000466975 CGTACTACTGGTTGTAATCGATAG pLX_317 100% 1.9% V5 (many diffs) n/a
Download CSV