Transcript: Human XR_950787.3

PREDICTED: Homo sapiens eukaryotic elongation factor 2 kinase (EEF2K), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EEF2K (29904)
Length:
2046
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_950787.3
NBCI Gene record:
EEF2K (29904)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_950787.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219747 CTCATGCCTGCAACCGGATTT pLKO.1 1406 3UTR 100% 10.800 15.120 N EEF2K n/a
2 TRCN0000234844 CTCATGCCTGCAACCGGATTT pLKO_005 1406 3UTR 100% 10.800 15.120 N EEF2K n/a
3 TRCN0000234845 CATGGCCACTCATACAGTAAT pLKO_005 1981 3UTR 100% 13.200 10.560 N EEF2K n/a
4 TRCN0000006223 CGATGAGGAAGGTTACTTCAT pLKO.1 570 3UTR 100% 4.950 3.960 N EEF2K n/a
5 TRCN0000006222 CCACTCATACAGTAATCGGAA pLKO.1 1986 3UTR 100% 2.640 2.112 N EEF2K n/a
6 TRCN0000006225 CTGGAAGATATTGCCACCGAA pLKO.1 784 3UTR 100% 2.640 2.112 N EEF2K n/a
7 TRCN0000219746 ATGTCAATTCCAAGGTTAATA pLKO.1 626 3UTR 100% 15.000 10.500 N EEF2K n/a
8 TRCN0000234843 ATGTCAATTCCAAGGTTAATA pLKO_005 626 3UTR 100% 15.000 10.500 N EEF2K n/a
9 TRCN0000006224 GCATCCAGAGACCATGATCAT pLKO.1 1870 3UTR 100% 4.950 3.465 N EEF2K n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_950787.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492335 CGCCGGACCCGCAATACTGAATTT pLX_317 2.3% 51.7% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489259 GACGTCGGACGCCTGTTGGGGTAA pLX_317 14% 51.6% V5 (many diffs) n/a
3 ccsbBroadEn_08135 pDONR223 100% 51.6% None (many diffs) n/a
4 ccsbBroad304_08135 pLX_304 0% 51.6% V5 (many diffs) n/a
5 TRCN0000472529 GGCTCGCTACGTGCTCCCGAATGA pLX_317 14.1% 51.6% V5 (many diffs) n/a
6 ccsbBroadEn_15051 pDONR223 0% 51.6% None (many diffs) n/a
7 ccsbBroad304_15051 pLX_304 0% 51.6% V5 (many diffs) n/a
8 TRCN0000492104 GTTATTGCCATCTCCAACGAGCAA pLX_317 11.7% 51.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV