Transcript: Human NR_146738.1

Homo sapiens arginyl-tRNA synthetase 2, mitochondrial (RARS2), transcript variant 11, non-coding RNA.

Source:
NCBI, updated 2018-05-10
Taxon:
Homo sapiens (human)
Gene:
RARS2 (57038)
Length:
2439
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_146738.1
NBCI Gene record:
RARS2 (57038)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_146738.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419542 ATCGAATGGACAAGTATAATT pLKO_005 1338 3UTR 100% 15.000 21.000 N RARS2 n/a
2 TRCN0000045347 ACCCAGGCATATCGTCAGTTA pLKO.1 1894 3UTR 100% 4.950 6.930 N RARS2 n/a
3 TRCN0000045343 GCGTTCTACCATCATAGGAAA pLKO.1 731 3UTR 100% 4.950 6.930 N RARS2 n/a
4 TRCN0000045345 CCTTTGGAGTAGTACAGGGAA pLKO.1 1470 3UTR 100% 2.640 3.696 N RARS2 n/a
5 TRCN0000422680 ACAAGCGTCTGGGAGTATATT pLKO_005 1110 3UTR 100% 15.000 10.500 N RARS2 n/a
6 TRCN0000434533 ACAGAACATGGCTTCAATTAA pLKO_005 1558 3UTR 100% 15.000 10.500 N RARS2 n/a
7 TRCN0000430156 ACTTCAAAGGTTTACTCTTAT pLKO_005 1650 3UTR 100% 13.200 9.240 N RARS2 n/a
8 TRCN0000413318 AGCTTTAGGACATCAAGTAAT pLKO_005 773 3UTR 100% 13.200 9.240 N RARS2 n/a
9 TRCN0000416164 CAATATCTGCAGTTCCAATTT pLKO_005 376 3UTR 100% 13.200 9.240 N RARS2 n/a
10 TRCN0000045344 CTCCTCAATTTGTACTGTAAT pLKO.1 1264 3UTR 100% 13.200 9.240 N RARS2 n/a
11 TRCN0000174075 CTCCTCAATTTGTACTGTAAT pLKO.1 1264 3UTR 100% 13.200 9.240 N RARS2 n/a
12 TRCN0000415333 GACAGTGCTACAACAAGTAAT pLKO_005 593 3UTR 100% 13.200 9.240 N RARS2 n/a
13 TRCN0000045346 GTACTGGTCAAAGGACTGTAA pLKO.1 541 3UTR 100% 4.950 3.465 N RARS2 n/a
14 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 2299 3UTR 100% 1.080 0.540 Y GPR83 n/a
15 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 2299 3UTR 100% 1.080 0.540 Y MYORG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_146738.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08690 pDONR223 100% 69.4% None (many diffs) n/a
2 ccsbBroad304_08690 pLX_304 0% 69.4% V5 (many diffs) n/a
3 TRCN0000471206 CACCCTGGCCCGAGACGGTGGCAC pLX_317 26.5% 69.4% V5 (many diffs) n/a
4 ccsbBroadEn_12325 pDONR223 100% 42.8% None (many diffs) n/a
5 ccsbBroad304_12325 pLX_304 0% 42.8% V5 (many diffs) n/a
6 TRCN0000467868 TCAAGAACTTATCCGTTACTCGCG pLX_317 36.3% 42.8% V5 (many diffs) n/a
Download CSV