Transcript: Human NM_001288752.2

Homo sapiens transmembrane serine protease 5 (TMPRSS5), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
TMPRSS5 (80975)
Length:
1961
CDS:
85..1251

Additional Resources:

NCBI RefSeq record:
NM_001288752.2
NBCI Gene record:
TMPRSS5 (80975)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001288752.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047076 CCTTGCAGGATGAGGAGATAA pLKO.1 332 CDS 100% 13.200 9.240 N TMPRSS5 n/a
2 TRCN0000047075 CCATACTTACAGCTCGGATAT pLKO.1 936 CDS 100% 10.800 7.560 N TMPRSS5 n/a
3 TRCN0000047073 CCCTGATTTCAGAGTCCTCTT pLKO.1 1439 3UTR 100% 4.050 2.835 N TMPRSS5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001288752.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12714 pDONR223 100% 76.5% 76.8% None (many diffs) n/a
2 ccsbBroad304_12714 pLX_304 0% 76.5% 76.8% V5 (many diffs) n/a
3 TRCN0000468489 TCCATTACACTCTTACTAGCCCTT pLX_317 28.8% 76.5% 76.8% V5 (many diffs) n/a
Download CSV