Transcript: Human XR_001747992.1

PREDICTED: Homo sapiens transmembrane serine protease 5 (TMPRSS5), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMPRSS5 (80975)
Length:
6798
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001747992.1
NBCI Gene record:
TMPRSS5 (80975)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001747992.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047076 CCTTGCAGGATGAGGAGATAA pLKO.1 3732 3UTR 100% 13.200 9.240 N TMPRSS5 n/a
2 TRCN0000047075 CCATACTTACAGCTCGGATAT pLKO.1 5771 3UTR 100% 10.800 7.560 N TMPRSS5 n/a
3 TRCN0000047074 GCACTTCTGGTCAAGTTGTTT pLKO.1 4071 3UTR 100% 5.625 3.938 N TMPRSS5 n/a
4 TRCN0000047077 GTCAAGTTGTTTCCCTCAGAT pLKO.1 4080 3UTR 100% 4.950 3.465 N TMPRSS5 n/a
5 TRCN0000047073 CCCTGATTTCAGAGTCCTCTT pLKO.1 6274 3UTR 100% 4.050 2.835 N TMPRSS5 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 9 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001747992.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12714 pDONR223 100% 18.6% None (many diffs) n/a
2 ccsbBroad304_12714 pLX_304 0% 18.6% V5 (many diffs) n/a
3 TRCN0000468489 TCCATTACACTCTTACTAGCCCTT pLX_317 28.8% 18.6% V5 (many diffs) n/a
4 ccsbBroadEn_13797 pDONR223 100% 2.3% None (many diffs) n/a
5 ccsbBroad304_13797 pLX_304 0% 2.3% V5 (many diffs) n/a
6 TRCN0000466975 CGTACTACTGGTTGTAATCGATAG pLX_317 100% 2.3% V5 (many diffs) n/a
7 ccsbBroadEn_15487 pDONR223 0% 2% None (many diffs) n/a
8 ccsbBroad304_15487 pLX_304 0% 2% V5 (many diffs) n/a
9 TRCN0000473708 TAGCATCGTTGCACGCGCACGTTG pLX_317 100% 2% V5 (many diffs) n/a
10 ccsbBroadEn_10261 pDONR223 100% .9% None (many diffs) n/a
11 ccsbBroad304_10261 pLX_304 0% .9% V5 (many diffs) n/a
12 TRCN0000492083 TTATAGGCCCAGAGCACTACCAAC pLX_317 100% .9% V5 (many diffs) n/a
Download CSV