Construct: ORF TRCN0000468809
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017882.4_s317c1
- Derived from:
- ccsbBroadEn_10407
- DNA Barcode:
- TGGCAGTTTGCGAAACGGTAAAAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PI4KAP1 (728233)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468809
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 375133 | PI4KAP2 | phosphatidylinositol 4-kina... | NR_003700.1 | 34.3% | (many diffs) | |
2 | human | 728233 | PI4KAP1 | phosphatidylinositol 4-kina... | NR_003563.1 | 33.3% | 1_30del;817_2360del | |
3 | human | 5297 | PI4KA | phosphatidylinositol 4-kina... | XM_017028830.1 | 17.4% | 17.2% | (many diffs) |
4 | human | 5297 | PI4KA | phosphatidylinositol 4-kina... | XM_005261635.1 | 13.8% | 13.7% | (many diffs) |
5 | human | 5297 | PI4KA | phosphatidylinositol 4-kina... | NM_001362862.1 | 12.3% | 12.2% | (many diffs) |
6 | human | 5297 | PI4KA | phosphatidylinositol 4-kina... | NM_001362863.1 | 12.3% | 12.1% | (many diffs) |
7 | human | 5297 | PI4KA | phosphatidylinositol 4-kina... | NM_058004.4 | 12.2% | 12% | (many diffs) |
8 | human | 5297 | PI4KA | phosphatidylinositol 4-kina... | XR_937868.1 | 11.6% | (many diffs) | |
9 | human | 5297 | PI4KA | phosphatidylinositol 4-kina... | XM_011530226.1 | 8.4% | 8.4% | (many diffs) |
10 | mouse | 224020 | Pi4ka | phosphatidylinositol 4-kina... | XM_006522037.2 | 19.7% | 21.3% | (many diffs) |
11 | mouse | 224020 | Pi4ka | phosphatidylinositol 4-kina... | NM_001001983.2 | 11.3% | 12.2% | (many diffs) |
12 | mouse | 224020 | Pi4ka | phosphatidylinositol 4-kina... | XM_006522034.1 | 10.9% | 11.8% | (many diffs) |
13 | mouse | 224020 | Pi4ka | phosphatidylinositol 4-kina... | XM_006522036.3 | 7.7% | 8.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 852
- ORF length:
- 786
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgac agtggagcag aaatttggcc tgttttctgc tgagataaag gaagcagacc 121 ccctggctgc ctcggaagca agtcaaccca aaccctgtcc ccccgaagtg accccccact 181 acatctggat cgacttcctg gtgcagcggt ttgagatcgc caagtactgc agctctgacc 241 aagtggagat cttctccagc ctgctgcagc gctccatgtc cctgaacatc ggtggggcca 301 aggggagcat gaaccggcat gtggcggcca tcgggccccg cttcaagctg ctgaccctgg 361 ggctgtccct cctgcatgcc gatgtggttc caaatgcaac catccgcaat gtgcttcgcg 421 agaagatcta ctccactgcc tttgactact tcagctgTCC CCCAAAGTTT CCTACTCAAG 481 GAGAGAAGCG GCTGCGTGAA GACATAAGCA TCATGATTAA ATTTTGGACC GCCATGTTCT 541 CAGATAAGAA GTACCTGACC GCCAGCCAGC TTGTTCCCCC AGCTGACATC GGCGACCTCC 601 GGGAGCAGTT AGTAGAGGAG AACACAGGCT CCTTGTCGGG CCCAGCGAAG GACTTTTACC 661 AGCGGGAGTT TGATTTCTTT AACAAGATCA CCAACGTGTC GGCTGTCATC AAGCCCTACC 721 CTAAAGGCGA CCAGAGAAAG AAGGCTTGTC TGTCGGCCCT GTCTGAAGTG ACGGTGCAGC 781 CAGGCTGCTC CCTGCCCAGC AACCCTGAAG CCATTGTGCT GGACGTCGAC TACAAGTCTG 841 GGACCCCGAT GTACCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 901 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 961 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGATGG CAGTTTGCGA AACGGTAAAA 1021 AACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t