Transcript: Human NM_001362862.1

Homo sapiens phosphatidylinositol 4-kinase alpha (PI4KA), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
PI4KA (5297)
Length:
6675
CDS:
88..6303

Additional Resources:

NCBI RefSeq record:
NM_001362862.1
NBCI Gene record:
PI4KA (5297)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001362862.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219839 GGCTATGTGCGGGAGTATATT pLKO.1 4993 CDS 100% 15.000 21.000 N PI4KA n/a
2 TRCN0000021202 GCGTCTCATCACATGGTACAA pLKO.1 4497 CDS 100% 4.950 3.960 N PI4KA n/a
3 TRCN0000344675 GCGTCTCATCACATGGTACAA pLKO_005 4497 CDS 100% 4.950 3.960 N PI4KA n/a
4 TRCN0000195510 CAAGGCTGGATCAACACATAC pLKO.1 4342 CDS 100% 10.800 7.560 N PI4KA n/a
5 TRCN0000344674 CAAGGCTGGATCAACACATAC pLKO_005 4342 CDS 100% 10.800 7.560 N PI4KA n/a
6 TRCN0000021199 GCCAGGTTTAAGAACACAGAA pLKO.1 4672 CDS 100% 4.950 3.465 N PI4KA n/a
7 TRCN0000021200 GCTGCACAAATACTACATGAA pLKO.1 4434 CDS 100% 4.950 3.465 N PI4KA n/a
8 TRCN0000021201 CCAGTTCATCTGGAACATGAA pLKO.1 5049 CDS 100% 0.495 0.347 N PI4KA n/a
9 TRCN0000219840 ACGACATGATCCAGTACTATC pLKO.1 6263 CDS 100% 10.800 6.480 N PI4KA n/a
10 TRCN0000333095 ACGACATGATCCAGTACTATC pLKO_005 6263 CDS 100% 10.800 6.480 N PI4KA n/a
11 TRCN0000021203 CAAGCTCTTGAAGCACAGGTT pLKO.1 6156 CDS 100% 2.640 1.584 N PI4KA n/a
12 TRCN0000052624 GCGGGAGTTTGATTTCTTTAA pLKO.1 5190 CDS 100% 13.200 6.600 Y PI4KAP2 n/a
13 TRCN0000199319 CGGAAGCAAGTCAACCCAAAC pLKO.1 3833 CDS 100% 6.000 3.000 Y PI4KAP2 n/a
14 TRCN0000052623 CGCCATGTTCTCAGATAAGAA pLKO.1 4230 CDS 100% 5.625 2.813 Y PI4KAP2 n/a
15 TRCN0000078691 CATCGACCTCTTCAAGAACAT pLKO.1 5586 CDS 100% 4.950 2.475 Y PI4KAP2 n/a
16 TRCN0000199012 CCCTCAAAGCTGTCCCACAAT pLKO.1 6337 3UTR 100% 4.950 2.475 Y PI4KA n/a
17 TRCN0000353014 CCCTCAAAGCTGTCCCACAAT pLKO_005 6337 3UTR 100% 4.950 2.475 Y PI4KA n/a
18 TRCN0000078688 CCTCTGTTTGCACTGGACATA pLKO.1 6530 3UTR 100% 4.950 2.475 Y PI4KAP2 n/a
19 TRCN0000078690 CGACCTCTTCAAGAACATCTT pLKO.1 5589 CDS 100% 4.950 2.475 Y PI4KAP2 n/a
20 TRCN0000194967 CGATGTGGAGTTAGTGAACTT pLKO.1 5425 CDS 100% 4.950 2.475 Y PI4KAP2 n/a
21 TRCN0000195375 CGGATGAGATGGTGATGATCA pLKO.1 5984 CDS 100% 4.950 2.475 Y PI4KAP2 n/a
22 TRCN0000195645 CTGACCAAGTGGAGATCTTCT pLKO.1 3935 CDS 100% 4.950 2.475 Y PI4KAP2 n/a
23 TRCN0000052626 GCGTGAAGACATAAGCATCAT pLKO.1 4194 CDS 100% 4.950 2.475 Y PI4KAP2 n/a
24 TRCN0000052625 CCACTACATCTGGATCGACTT pLKO.1 3876 CDS 100% 4.050 2.025 Y PI4KAP2 n/a
25 TRCN0000078689 CGGCAACATTATGCTGGACAA pLKO.1 5874 CDS 100% 4.050 2.025 Y PI4KAP2 n/a
26 TRCN0000052627 CCGATGTGGTTCCAAATGCAA pLKO.1 4079 CDS 100% 3.000 1.500 Y PI4KAP2 n/a
27 TRCN0000174244 CCGATGTGGTTCCAAATGCAA pLKO.1 4079 CDS 100% 3.000 1.500 Y PI4KAP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001362862.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488521 GAACTTAAACATACCTTACTTGCC pLX_317 6.4% 95.7% 95.7% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488590 GTCGTTCACTGAGACAACATCATC pLX_317 5.7% 95.6% 95.7% V5 (many diffs) n/a
3 ccsbBroadEn_14764 pDONR223 65.1% 40.8% 10.7% None (many diffs) n/a
4 ccsbBroad304_14764 pLX_304 0% 40.8% 10.7% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000474192 ATTATATGCGTACAATAACACCCC pLX_317 15% 40.8% 10.7% V5 (not translated due to prior stop codon) (many diffs) n/a
6 ccsbBroadEn_13633 pDONR223 100% 27.2% 26% None (many diffs) n/a
7 ccsbBroad304_13633 pLX_304 0% 27.2% 26% V5 (many diffs) n/a
8 TRCN0000477717 ATTCCACATTACTGCATATGACGG pLX_317 16.3% 27.2% 26% V5 (many diffs) n/a
9 ccsbBroadEn_15289 pDONR223 0% 27.2% 26% None (many diffs) n/a
10 ccsbBroad304_15289 pLX_304 0% 27.2% 26% V5 (many diffs) n/a
11 ccsbBroadEn_10407 pDONR223 100% 12.3% 12.2% None (many diffs) n/a
12 ccsbBroad304_10407 pLX_304 0% 12.3% 12.2% V5 (many diffs) n/a
13 TRCN0000468809 TGGCAGTTTGCGAAACGGTAAAAA pLX_317 50.2% 12.3% 12.2% V5 (many diffs) n/a
14 ccsbBroadEn_15314 pDONR223 0% 12.3% 12.2% None (many diffs) n/a
15 ccsbBroad304_15314 pLX_304 0% 12.3% 12.2% V5 (many diffs) n/a
16 TRCN0000466007 ACAACCTTGACCTCCTCTTCCTCT pLX_317 48.3% 12.3% 12.2% V5 (many diffs) n/a
Download CSV