Transcript: Human NR_003563.1

Homo sapiens phosphatidylinositol 4-kinase alpha pseudogene 1 (PI4KAP1), non-coding RNA.

Source:
NCBI, updated 2018-06-03
Taxon:
Homo sapiens (human)
Gene:
PI4KAP1 (728233)
Length:
2360
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_003563.1
NBCI Gene record:
PI4KAP1 (728233)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_003563.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052624 GCGGGAGTTTGATTTCTTTAA pLKO.1 627 3UTR 100% 13.200 6.600 Y PI4KAP2 n/a
2 TRCN0000199319 CGGAAGCAAGTCAACCCAAAC pLKO.1 98 3UTR 100% 6.000 3.000 Y PI4KAP2 n/a
3 TRCN0000052623 CGCCATGTTCTCAGATAAGAA pLKO.1 495 3UTR 100% 5.625 2.813 Y PI4KAP2 n/a
4 TRCN0000078691 CATCGACCTCTTCAAGAACAT pLKO.1 1023 3UTR 100% 4.950 2.475 Y PI4KAP2 n/a
5 TRCN0000078690 CGACCTCTTCAAGAACATCTT pLKO.1 1026 3UTR 100% 4.950 2.475 Y PI4KAP2 n/a
6 TRCN0000194967 CGATGTGGAGTTAGTGAACTT pLKO.1 862 3UTR 100% 4.950 2.475 Y PI4KAP2 n/a
7 TRCN0000195375 CGGATGAGATGGTGATGATCA pLKO.1 1904 3UTR 100% 4.950 2.475 Y PI4KAP2 n/a
8 TRCN0000195645 CTGACCAAGTGGAGATCTTCT pLKO.1 200 3UTR 100% 4.950 2.475 Y PI4KAP2 n/a
9 TRCN0000052626 GCGTGAAGACATAAGCATCAT pLKO.1 459 3UTR 100% 4.950 2.475 Y PI4KAP2 n/a
10 TRCN0000078692 GTTTCCTACTCAAGGAGAGAA pLKO.1 432 3UTR 100% 4.950 2.475 Y PI4KAP2 n/a
11 TRCN0000052625 CCACTACATCTGGATCGACTT pLKO.1 141 3UTR 100% 4.050 2.025 Y PI4KAP2 n/a
12 TRCN0000078689 CGGCAACATTATGCTGGACAA pLKO.1 1311 3UTR 100% 4.050 2.025 Y PI4KAP2 n/a
13 TRCN0000052627 CCGATGTGGTTCCAAATGCAA pLKO.1 344 3UTR 100% 3.000 1.500 Y PI4KAP2 n/a
14 TRCN0000174244 CCGATGTGGTTCCAAATGCAA pLKO.1 344 3UTR 100% 3.000 1.500 Y PI4KAP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_003563.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13633 pDONR223 100% 66.8% None (many diffs) n/a
2 ccsbBroad304_13633 pLX_304 0% 66.8% V5 (many diffs) n/a
3 TRCN0000477717 ATTCCACATTACTGCATATGACGG pLX_317 16.3% 66.8% V5 (many diffs) n/a
4 ccsbBroadEn_15289 pDONR223 0% 66.8% None (many diffs) n/a
5 ccsbBroad304_15289 pLX_304 0% 66.8% V5 (many diffs) n/a
6 ccsbBroadEn_14764 pDONR223 65.1% 52.9% None (many diffs) n/a
7 ccsbBroad304_14764 pLX_304 0% 52.9% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000474192 ATTATATGCGTACAATAACACCCC pLX_317 15% 52.9% V5 (not translated due to prior stop codon) (many diffs) n/a
9 ccsbBroadEn_10407 pDONR223 100% 33.3% None 1_30del;817_2360del n/a
10 ccsbBroad304_10407 pLX_304 0% 33.3% V5 1_30del;817_2360del n/a
11 TRCN0000468809 TGGCAGTTTGCGAAACGGTAAAAA pLX_317 50.2% 33.3% V5 1_30del;817_2360del n/a
12 ccsbBroadEn_15314 pDONR223 0% 33.3% None 1_30del;817_2360del n/a
13 ccsbBroad304_15314 pLX_304 0% 33.3% V5 1_30del;817_2360del n/a
14 TRCN0000466007 ACAACCTTGACCTCCTCTTCCTCT pLX_317 48.3% 33.3% V5 1_30del;817_2360del n/a
15 TRCN0000488590 GTCGTTCACTGAGACAACATCATC pLX_317 5.7% 25.2% V5 (many diffs) n/a
16 TRCN0000488521 GAACTTAAACATACCTTACTTGCC pLX_317 6.4% 25.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV