Transcript: Mouse NM_001001983.2

Mus musculus phosphatidylinositol 4-kinase alpha (Pi4ka), mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Pi4ka (224020)
Length:
6449
CDS:
79..6213

Additional Resources:

NCBI RefSeq record:
NM_001001983.2
NBCI Gene record:
Pi4ka (224020)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001001983.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079038 GCCTTGAGTGTCACAGAGCAA pLKO.1 6236 3UTR 100% 2.640 2.112 N Pi4ka n/a
2 TRCN0000311975 GCCTTGAGTGTCACAGAGCAA pLKO_005 6236 3UTR 100% 2.640 2.112 N Pi4ka n/a
3 TRCN0000079042 GCGGAGTGAGTGAACTTGAAA pLKO.1 5339 CDS 100% 5.625 3.938 N Pi4ka n/a
4 TRCN0000311900 GCGGAGTGAGTGAACTTGAAA pLKO_005 5339 CDS 100% 5.625 3.938 N Pi4ka n/a
5 TRCN0000078691 CATCGACCTCTTCAAGAACAT pLKO.1 5496 CDS 100% 4.950 3.465 N PI4KAP2 n/a
6 TRCN0000079039 CCAGTTTATTTGGAACATGAA pLKO.1 4959 CDS 100% 4.950 3.465 N Pi4ka n/a
7 TRCN0000311899 CCAGTTTATTTGGAACATGAA pLKO_005 4959 CDS 100% 4.950 3.465 N Pi4ka n/a
8 TRCN0000078690 CGACCTCTTCAAGAACATCTT pLKO.1 5499 CDS 100% 4.950 3.465 N PI4KAP2 n/a
9 TRCN0000079040 GCTCCGAAGTACCATCATCAA pLKO.1 2493 CDS 100% 4.950 3.465 N Pi4ka n/a
10 TRCN0000079041 GCAGTCCAAGACATCCAGTAA pLKO.1 1302 CDS 100% 4.950 2.970 N Pi4ka n/a
11 TRCN0000311898 GCAGTCCAAGACATCCAGTAA pLKO_005 1302 CDS 100% 4.950 2.970 N Pi4ka n/a
12 TRCN0000219840 ACGACATGATCCAGTACTATC pLKO.1 6173 CDS 100% 10.800 15.120 N PI4KA n/a
13 TRCN0000333095 ACGACATGATCCAGTACTATC pLKO_005 6173 CDS 100% 10.800 15.120 N PI4KA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001001983.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488521 GAACTTAAACATACCTTACTTGCC pLX_317 6.4% 89.2% 97.6% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488590 GTCGTTCACTGAGACAACATCATC pLX_317 5.7% 89.2% 97.6% V5 (many diffs) n/a
3 ccsbBroadEn_14764 pDONR223 65.1% 37% 10.7% None (many diffs) n/a
4 ccsbBroad304_14764 pLX_304 0% 37% 10.7% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000474192 ATTATATGCGTACAATAACACCCC pLX_317 15% 37% 10.7% V5 (not translated due to prior stop codon) (many diffs) n/a
6 ccsbBroadEn_13633 pDONR223 100% 24.8% 25.8% None (many diffs) n/a
7 ccsbBroad304_13633 pLX_304 0% 24.8% 25.8% V5 (many diffs) n/a
8 TRCN0000477717 ATTCCACATTACTGCATATGACGG pLX_317 16.3% 24.8% 25.8% V5 (many diffs) n/a
9 ccsbBroadEn_15289 pDONR223 0% 24.8% 25.8% None (many diffs) n/a
10 ccsbBroad304_15289 pLX_304 0% 24.8% 25.8% V5 (many diffs) n/a
11 ccsbBroadEn_10407 pDONR223 100% 11.3% 12.2% None (many diffs) n/a
12 ccsbBroad304_10407 pLX_304 0% 11.3% 12.2% V5 (many diffs) n/a
13 TRCN0000468809 TGGCAGTTTGCGAAACGGTAAAAA pLX_317 50.2% 11.3% 12.2% V5 (many diffs) n/a
14 ccsbBroadEn_15314 pDONR223 0% 11.3% 12.2% None (many diffs) n/a
15 ccsbBroad304_15314 pLX_304 0% 11.3% 12.2% V5 (many diffs) n/a
16 TRCN0000466007 ACAACCTTGACCTCCTCTTCCTCT pLX_317 48.3% 11.3% 12.2% V5 (many diffs) n/a
Download CSV