Construct: ORF TRCN0000472523
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001648.1_s317c1
- Derived from:
- ccsbBroadEn_12859
- DNA Barcode:
- CGATTTAGGCAGATTCCTTAACCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RTN4IP1 (84816)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472523
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 84816 | RTN4IP1 | reticulon 4 interacting pro... | NM_032730.5 | 89.3% | 89.3% | 1_126del |
| 2 | human | 84816 | RTN4IP1 | reticulon 4 interacting pro... | XM_011536192.2 | 88.4% | 86.4% | (many diffs) |
| 3 | human | 84816 | RTN4IP1 | reticulon 4 interacting pro... | NM_001318746.1 | 83.6% | 83.6% | 0_1ins174 |
| 4 | human | 84816 | RTN4IP1 | reticulon 4 interacting pro... | XM_017011376.2 | 62.1% | 58.5% | 1_126del;806_807ins184;864_865ins140 |
| 5 | human | 84816 | RTN4IP1 | reticulon 4 interacting pro... | XR_001743693.2 | 29.7% | (many diffs) | |
| 6 | mouse | 170728 | Rtn4ip1 | reticulon 4 interacting pro... | NM_130892.5 | 79.6% | 82.8% | (many diffs) |
| 7 | mouse | 170728 | Rtn4ip1 | reticulon 4 interacting pro... | NR_152603.1 | 30.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1128
- ORF length:
- 1062
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc tgcttgggtg atagataaat atgggaagaa tgaagtgctt cgattcactc 121 agaacatgat gatgcctatc atacactatc caaatgaagt cattgtcaaa gttcacgctg 181 ccagtgtaaa tcctatagac gttaatatga gaagtggtta tggagctaca gctttaaata 241 tgaagcgtga tcctttacac gtgaaaatca aaggagaaga atttcctctg actctgggtc 301 gggatgtctc tggcgtggtg atggaatgtg ggcttgatgt gaaatacttc aagcctggag 361 atgaggtctg ggctgcagtt cctccttgga aacaaggcac tctttcagag tttgttgtag 421 tcagtgggaa tgaggtctct cacaaaccca aatcactcac tcatactcaa gctgcctctt 481 tgccatatgt ggctctcaca gcctggtctg ctataaacaa agttggtggc ctgaatgaca 541 agaattgcac aggaaaacgt gttctaatct taggcgcttc aggcggagtt ggtacttttg 601 ctatacaggt aatgaaagca tgggatgctc atgtgacagc agtttgctcc caagatgcca 661 gtgaacttgt aaggaagctt ggtgcagacg atgtaattga ttacaaatct ggaagtgtgg 721 aagagcagtt gaaatcctta aaaccatttG ATTTTATCCT TGATAATGTT GGCGGATCCA 781 CTGAAACATG GGCTCCAGAT TTTCTCAAGA AATGGTCAGG AGCCACCTAT GTGACTTTGG 841 TGACTCCTTT CCTCCTGAAC ATGGACCGAT TGGGCATAGC AGATGGCATG TTGCAGACAG 901 GAGTCACTGT AGGTTCAAAG GCATTAAAGC ATTTCTGGAA AGGAGTCCAT TATCGCTGGG 961 CATTTTTCAT GGCCAGTGGC CCATGTTTAG ATGACATTGC AGAACTGGTG GATGCGGGAA 1021 AGATCCGGCC AGTTATTGAA CAAACCTTTC CTTTTTCTAA AGTTCCAGAA GCCTTCCTGA 1081 AGGTGGAAAG AGGACACGCA CGAGGAAAGA CTGTAATTAA TGTTGTTTAC CCAACTTTCT 1141 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 1201 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 1261 GTGGAAAGGA CGACGATTTA GGCAGATTCC TTAACCAACG CGTTAAGTCg acaatcaacc 1321 tctggattac aaaatttgtg aaagatt