Transcript: Human XR_001743693.2

PREDICTED: Homo sapiens reticulon 4 interacting protein 1 (RTN4IP1), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RTN4IP1 (84816)
Length:
3542
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001743693.2
NBCI Gene record:
RTN4IP1 (84816)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001743693.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219631 CCTATCATACACTATCCAAAT pLKO.1 1492 3UTR 100% 10.800 15.120 N Rtn4ip1 n/a
2 TRCN0000157614 GTCCATTATCGCTGGGCATTT pLKO.1 2302 3UTR 100% 10.800 15.120 N RTN4IP1 n/a
3 TRCN0000153906 CAAGGCACTCTTTCAGAGTTT pLKO.1 1750 3UTR 100% 4.950 3.960 N RTN4IP1 n/a
4 TRCN0000153879 CGTGATCCTTTACACGTGAAA pLKO.1 1603 3UTR 100% 4.950 3.960 N RTN4IP1 n/a
5 TRCN0000153224 GCTGCCAGTGTAAATCCTATA pLKO.1 1534 3UTR 100% 10.800 7.560 N RTN4IP1 n/a
6 TRCN0000151630 GAAGAATGAAGTGCTTCGATT pLKO.1 1452 3UTR 100% 4.950 3.465 N RTN4IP1 n/a
7 TRCN0000153419 GCTTCGATTCACTCAGAACAT pLKO.1 1464 3UTR 100% 4.950 3.465 N RTN4IP1 n/a
8 TRCN0000152484 CAGGTAATGAAAGCATGGGAT pLKO.1 1963 3UTR 100% 2.640 1.848 N RTN4IP1 n/a
9 TRCN0000157615 GACATTGCAGAACTGGTGGAT pLKO.1 2350 3UTR 100% 2.640 1.848 N RTN4IP1 n/a
10 TRCN0000152895 GTGTTCTAATCTTAGGCGCTT pLKO.1 1916 3UTR 100% 2.160 1.512 N RTN4IP1 n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3235 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3235 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001743693.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12859 pDONR223 100% 29.7% None (many diffs) n/a
2 ccsbBroad304_12859 pLX_304 0% 29.7% V5 (many diffs) n/a
3 TRCN0000472523 CGATTTAGGCAGATTCCTTAACCA pLX_317 35.9% 29.7% V5 (many diffs) n/a
4 ccsbBroadEn_13781 pDONR223 100% 6.9% None (many diffs) n/a
5 ccsbBroad304_13781 pLX_304 0% 6.9% V5 (many diffs) n/a
6 TRCN0000469746 TCCCTGCGCCGTCCGGGTTTTCGA pLX_317 100% 6.9% V5 (many diffs) n/a
7 ccsbBroadEn_11616 pDONR223 100% 4.7% None (many diffs) n/a
8 ccsbBroad304_11616 pLX_304 0% 4.7% V5 (many diffs) n/a
9 TRCN0000467678 CCTCCCCTCACACCTCGTCAAAAC pLX_317 100% 4.7% V5 (many diffs) n/a
Download CSV