Transcript: Human XM_017023631.2

PREDICTED: Homo sapiens nuclear pore complex interacting protein family member B6 (NPIPB6), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NPIPB6 (728741)
Length:
2024
CDS:
899..1939

Additional Resources:

NCBI RefSeq record:
XM_017023631.2
NBCI Gene record:
NPIPB6 (728741)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023631.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139541 CCACCCTCAGTGGATGATAAT pLKO.1 1538 CDS 100% 13.200 6.600 Y NPIPB15 n/a
2 TRCN0000256804 TTGGCCTGAAAGACGTCATTA pLKO_005 1125 CDS 100% 13.200 6.600 Y NPIPB3 n/a
3 TRCN0000284749 TGGCCTGAAAGACGTCATTAC pLKO_005 1126 CDS 100% 10.800 5.400 Y NPIPB5 n/a
4 TRCN0000141615 CCTCCAACTCAACAACATTCT pLKO.1 1460 CDS 100% 4.950 2.475 Y NPIPA1 n/a
5 TRCN0000152162 CTGAAAGACGTCATTACTCTA pLKO.1 1130 CDS 100% 4.950 2.475 Y NPIPB7 n/a
6 TRCN0000141507 CTTCTGCAAGAAAGCCTCTTT pLKO.1 1329 CDS 100% 4.950 2.475 Y NPIPB15 n/a
7 TRCN0000141710 GAGGACTACCACAAATGCAAA pLKO.1 1301 CDS 100% 4.950 2.475 Y NPIPB15 n/a
8 TRCN0000140070 GAGGTGGAACAATCACCGAAA pLKO.1 1760 CDS 100% 4.050 2.025 Y NPIPB15 n/a
9 TRCN0000140729 GCTGGGATTTATCAGCCATCA pLKO.1 934 CDS 100% 4.050 2.025 Y NPIPB15 n/a
10 TRCN0000141673 CCTCAGTGGATGATAATCTCA pLKO.1 1668 CDS 100% 3.000 1.500 Y NPIPB15 n/a
11 TRCN0000141237 CCTCAGTGGATGATAATCTGA pLKO.1 1605 CDS 100% 3.000 1.500 Y NPIPB15 n/a
12 TRCN0000140069 GTCATTACTCTACGGAGGCAT pLKO.1 1139 CDS 100% 2.640 1.320 Y NPIPB15 n/a
13 TRCN0000154791 GTCATTACTCTACGGAGGCAT pLKO.1 1139 CDS 100% 2.640 1.320 Y NPIPB7 n/a
14 TRCN0000140776 GAATGTCTCTTTGTCCCGCTT pLKO.1 1628 CDS 100% 2.160 1.080 Y NPIPB15 n/a
15 TRCN0000150531 GTTTCTTCCTTTCGAGGAAAT pLKO.1 1100 CDS 100% 1.080 0.540 Y NPIPB7 n/a
16 TRCN0000145269 GTCTTTCCTGAAGACTATCTT pLKO.1 967 CDS 100% 0.563 0.281 Y NPIPB15 n/a
17 TRCN0000144748 GTCCATTTGTATGCACACAAA pLKO.1 1072 CDS 100% 0.495 0.248 Y NPIPB15 n/a
18 TRCN0000139444 CCTGTGTCTTTCCTGAAGACT pLKO.1 962 CDS 100% 0.300 0.150 Y NPIPB15 n/a
19 TRCN0000156135 CCTGTGTCTTTCCTGAAGACT pLKO.1 962 CDS 100% 0.300 0.150 Y NPIPB7 n/a
20 TRCN0000264026 TACCTCACAGCTGAAACTTTA pLKO_005 1412 CDS 100% 0.000 0.000 Y PKD1P1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023631.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13743 pDONR223 100% 74.3% 71.3% None (many diffs) n/a
2 ccsbBroad304_13743 pLX_304 0% 74.3% 71.3% V5 (many diffs) n/a
3 TRCN0000477724 CCAAAATCCTACACAGGAGGTGAC pLX_317 25.2% 74.3% 71.3% V5 (many diffs) n/a
4 ccsbBroadEn_15006 pDONR223 47.5% 45.6% 42.7% None (many diffs) n/a
5 ccsbBroad304_15006 pLX_304 0% 45.6% 42.7% V5 (not translated due to prior stop codon) (many diffs) n/a
6 ccsbBroadEn_15304 pDONR223 57.8% 34.7% 26.7% None (many diffs) n/a
7 ccsbBroad304_15304 pLX_304 0% 34.7% 26.7% V5 (many diffs) n/a
8 TRCN0000465408 CACCCATAGAAGAATTACCGCCGA pLX_317 100% 18.4% 16.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV