Transcript: Human XM_024450387.1

PREDICTED: Homo sapiens nuclear pore complex interacting protein family member A2 (NPIPA2), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NPIPA2 (642799)
Length:
3416
CDS:
2320..3390

Additional Resources:

NCBI RefSeq record:
XM_024450387.1
NBCI Gene record:
NPIPA2 (642799)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450387.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264027 CGTAGACAGGAAGGAATTAAA pLKO_005 2743 CDS 100% 15.000 7.500 Y PKD1P1 n/a
2 TRCN0000264029 CCACCCTCAGCGGATGATAAT pLKO_005 3298 CDS 100% 13.200 6.600 Y PKD1P1 n/a
3 TRCN0000140226 GCCGTAGACAGGAAGGAATTA pLKO.1 2741 CDS 100% 13.200 6.600 Y NPIPA1 n/a
4 TRCN0000256807 TCCACCCTCAGCGGATGATAA pLKO_005 3297 CDS 100% 13.200 6.600 Y NPIPB3 n/a
5 TRCN0000264025 TGGAAGTCCTTGGTTACTTAT pLKO_005 2574 CDS 100% 13.200 6.600 Y PKD1P1 n/a
6 TRCN0000135831 CCCTGTTCTCATTCTGCAAAT pLKO.1 2301 5UTR 100% 10.800 5.400 Y PDXDC2P-NPIPB14P n/a
7 TRCN0000145199 GAAACCAAAGTTCGAGCTAAA pLKO.1 2803 CDS 100% 10.800 5.400 Y NPIPA1 n/a
8 TRCN0000145534 CTGAGGAAACTAAGCATGAAA pLKO.1 2902 CDS 100% 5.625 2.813 Y NPIPA1 n/a
9 TRCN0000141615 CCTCCAACTCAACAACATTCT pLKO.1 3208 CDS 100% 4.950 2.475 Y NPIPA1 n/a
10 TRCN0000141507 CTTCTGCAAGAAAGCCTCTTT pLKO.1 3077 CDS 100% 4.950 2.475 Y NPIPB15 n/a
11 TRCN0000142420 GAGGACTACTACAGATGCAAA pLKO.1 3049 CDS 100% 4.950 2.475 Y NPIPA1 n/a
12 TRCN0000144792 GTAAGATGAAGGTGACAACAA pLKO.1 2828 CDS 100% 4.950 2.475 Y NPIPA1 n/a
13 TRCN0000145269 GTCTTTCCTGAAGACTATCTT pLKO.1 2658 CDS 100% 0.563 0.281 Y NPIPB15 n/a
14 TRCN0000264026 TACCTCACAGCTGAAACTTTA pLKO_005 3160 CDS 100% 0.000 0.000 Y PKD1P1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450387.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16160 pDONR223 0% 61% 55% None (many diffs) n/a
2 ccsbBroad304_16160 pLX_304 0% 61% 55% V5 (many diffs) n/a
3 TRCN0000473627 ATCAATCAGAAAGTCAGCTAAGTC pLX_317 59.4% 61% 55% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_13743 pDONR223 100% 51.7% 43% None (many diffs) n/a
5 ccsbBroad304_13743 pLX_304 0% 51.7% 43% V5 (many diffs) n/a
6 TRCN0000477724 CCAAAATCCTACACAGGAGGTGAC pLX_317 25.2% 51.7% 43% V5 (many diffs) n/a
7 ccsbBroadEn_15304 pDONR223 57.8% 21.2% 21.3% None (many diffs) n/a
8 ccsbBroad304_15304 pLX_304 0% 21.2% 21.3% V5 (many diffs) n/a
9 TRCN0000465408 CACCCATAGAAGAATTACCGCCGA pLX_317 100% 18.6% 17.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV