Transcript: Human XM_011523501.2

PREDICTED: Homo sapiens nuclear pore complex interacting protein family member B15 (NPIPB15), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NPIPB15 (440348)
Length:
1271
CDS:
454..1236

Additional Resources:

NCBI RefSeq record:
XM_011523501.2
NBCI Gene record:
NPIPB15 (440348)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011523501.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139541 CCACCCTCAGTGGATGATAAT pLKO.1 727 CDS 100% 13.200 6.600 Y NPIPB15 n/a
2 TRCN0000141615 CCTCCAACTCAACAACATTCT pLKO.1 649 CDS 100% 4.950 2.475 Y NPIPA1 n/a
3 TRCN0000141507 CTTCTGCAAGAAAGCCTCTTT pLKO.1 518 CDS 100% 4.950 2.475 Y NPIPB15 n/a
4 TRCN0000141710 GAGGACTACCACAAATGCAAA pLKO.1 490 CDS 100% 4.950 2.475 Y NPIPB15 n/a
5 TRCN0000140070 GAGGTGGAACAATCACCGAAA pLKO.1 997 CDS 100% 4.050 2.025 Y NPIPB15 n/a
6 TRCN0000141673 CCTCAGTGGATGATAATCTCA pLKO.1 905 CDS 100% 3.000 1.500 Y NPIPB15 n/a
7 TRCN0000141237 CCTCAGTGGATGATAATCTGA pLKO.1 779 CDS 100% 3.000 1.500 Y NPIPB15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011523501.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13743 pDONR223 100% 49.2% 48.4% None (many diffs) n/a
2 ccsbBroad304_13743 pLX_304 0% 49.2% 48.4% V5 (many diffs) n/a
3 TRCN0000477724 CCAAAATCCTACACAGGAGGTGAC pLX_317 25.2% 49.2% 48.4% V5 (many diffs) n/a
4 ccsbBroadEn_15304 pDONR223 57.8% 43.9% 38.4% None (many diffs) n/a
5 ccsbBroad304_15304 pLX_304 0% 43.9% 38.4% V5 (many diffs) n/a
6 TRCN0000465408 CACCCATAGAAGAATTACCGCCGA pLX_317 100% 24.2% 21.9% V5 (not translated due to prior stop codon) (many diffs) n/a
7 ccsbBroadEn_15006 pDONR223 47.5% 31.7% 18.5% None (many diffs) n/a
8 ccsbBroad304_15006 pLX_304 0% 31.7% 18.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV