Transcript: Human XM_024450429.1

PREDICTED: Homo sapiens nuclear pore complex interacting protein family member B2 (NPIPB2), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NPIPB2 (729978)
Length:
1168
CDS:
459..1058

Additional Resources:

NCBI RefSeq record:
XM_024450429.1
NBCI Gene record:
NPIPB2 (729978)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450429.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264029 CCACCCTCAGCGGATGATAAT pLKO_005 732 CDS 100% 13.200 6.600 Y PKD1P1 n/a
2 TRCN0000256807 TCCACCCTCAGCGGATGATAA pLKO_005 731 CDS 100% 13.200 6.600 Y NPIPB3 n/a
3 TRCN0000141615 CCTCCAACTCAACAACATTCT pLKO.1 654 CDS 100% 4.950 2.475 Y NPIPA1 n/a
4 TRCN0000141710 GAGGACTACCACAAATGCAAA pLKO.1 495 CDS 100% 4.950 2.475 Y NPIPB15 n/a
5 TRCN0000264026 TACCTCACAGCTGAAACTTTA pLKO_005 606 CDS 100% 0.000 0.000 Y PKD1P1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450429.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15304 pDONR223 57.8% 55.3% 48.3% None (many diffs) n/a
2 ccsbBroad304_15304 pLX_304 0% 55.3% 48.3% V5 (many diffs) n/a
3 TRCN0000465408 CACCCATAGAAGAATTACCGCCGA pLX_317 100% 33.1% 31.1% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_13743 pDONR223 100% 39.8% 36.6% None (many diffs) n/a
5 ccsbBroad304_13743 pLX_304 0% 39.8% 36.6% V5 (many diffs) n/a
6 TRCN0000477724 CCAAAATCCTACACAGGAGGTGAC pLX_317 25.2% 39.8% 36.6% V5 (many diffs) n/a
7 ccsbBroadEn_15006 pDONR223 47.5% 27.8% 22.7% None (many diffs) n/a
8 ccsbBroad304_15006 pLX_304 0% 27.8% 22.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV