Transcript: Human XM_005265855.5

PREDICTED: Homo sapiens F-box and WD repeat domain containing 11 (FBXW11), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FBXW11 (23291)
Length:
7372
CDS:
3103..4794

Additional Resources:

NCBI RefSeq record:
XM_005265855.5
NBCI Gene record:
FBXW11 (23291)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005265855.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231302 CCATGTTGCAGCGGGACTTTA pLKO_005 3503 CDS 100% 13.200 18.480 N Fbxw11 n/a
2 TRCN0000315268 CCGATGCATCCGGTTTGATAA pLKO_005 4503 CDS 100% 13.200 18.480 N FBXW11 n/a
3 TRCN0000369053 ACATTGTGTTTGCGCACATTG pLKO_005 4609 CDS 100% 10.800 15.120 N FBXW11 n/a
4 TRCN0000004343 GAACGAATGGTACGCACTGAT pLKO.1 3670 CDS 100% 4.950 6.930 N FBXW11 n/a
5 TRCN0000004342 TCGTACTCTCAATGGGCACAA pLKO.1 4353 CDS 100% 4.050 5.670 N FBXW11 n/a
6 TRCN0000315200 AGAAGACTTGGCCTCTAATTT pLKO_005 5133 3UTR 100% 15.000 10.500 N FBXW11 n/a
7 TRCN0000369109 ACTCTTCAAGTACCGACATTT pLKO_005 4938 3UTR 100% 13.200 9.240 N FBXW11 n/a
8 TRCN0000012810 GCTCCCATGATGACACTATTT pLKO.1 4688 CDS 100% 13.200 9.240 N Fbxw11 n/a
9 TRCN0000231305 GCTCCCATGATGACACTATTT pLKO_005 4688 CDS 100% 13.200 9.240 N Fbxw11 n/a
10 TRCN0000315280 GCTCCCATGATGACACTATTT pLKO_005 4688 CDS 100% 13.200 9.240 N FBXW11 n/a
11 TRCN0000315269 TATCAGTGGCCTACGAGATAA pLKO_005 3924 CDS 100% 13.200 9.240 N FBXW11 n/a
12 TRCN0000369108 ATCATCAGATAATACCATTAG pLKO_005 4422 CDS 100% 10.800 7.560 N FBXW11 n/a
13 TRCN0000004345 CCATCAGAAGGAAACTATCAA pLKO.1 3355 CDS 100% 5.625 3.938 N FBXW11 n/a
14 TRCN0000004344 GTCCAGTAAATTGCTAAGTAA pLKO.1 7237 3UTR 100% 5.625 3.938 N FBXW11 n/a
15 TRCN0000012811 GCATGGACATATTAACTCTTA pLKO.1 3474 CDS 100% 4.950 3.465 N Fbxw11 n/a
16 TRCN0000012812 GCTTTACCAGAGCAAGGCTTA pLKO.1 3529 CDS 100% 4.050 2.835 N Fbxw11 n/a
17 TRCN0000004346 GTGTCATTGTAACTGGCTCTT pLKO.1 4037 CDS 100% 4.050 2.835 N FBXW11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005265855.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02746 pDONR223 100% 93.9% 93.9% None 45_146del n/a
2 ccsbBroad304_02746 pLX_304 0% 93.9% 93.9% V5 45_146del n/a
3 TRCN0000481639 CACAACATGCATTGCGAAATGTCA pLX_317 29.6% 93.9% 93.9% V5 45_146del n/a
Download CSV