Transcript: Human NM_000154.2

Homo sapiens galactokinase 1 (GALK1), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
GALK1 (2584)
Length:
1397
CDS:
57..1235

Additional Resources:

NCBI RefSeq record:
NM_000154.2
NBCI Gene record:
GALK1 (2584)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000154.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433580 TGCTCATTGACTGCAGGTCCT pLKO_005 652 CDS 100% 2.160 3.024 N GALK1 n/a
2 TRCN0000199283 CCTTGGAAGTGGCCACGTACA pLKO.1 487 CDS 100% 1.350 1.890 N GALK1 n/a
3 TRCN0000010058 CCAGACTCGGGCACAATAGCT pLKO.1 528 CDS 100% 1.000 1.400 N GALK1 n/a
4 TRCN0000010059 CACCAACTCTAATGTCCGCCA pLKO.1 722 CDS 100% 0.540 0.756 N GALK1 n/a
5 TRCN0000199838 CCCTGAGACGTGGCGACTACA pLKO.1 937 CDS 100% 0.000 0.000 N GALK1 n/a
6 TRCN0000380567 GGACCAGTTCATCTCACTTAT pLKO_005 611 CDS 100% 13.200 10.560 N GALK1 n/a
7 TRCN0000199931 GAGACGACTATGAGGTGAGCT pLKO.1 1000 CDS 100% 2.640 2.112 N GALK1 n/a
8 TRCN0000381153 ACTATGTCAAGGGAGTGATTC pLKO_005 379 CDS 100% 10.800 7.560 N GALK1 n/a
9 TRCN0000380242 GCTCACTCAGAGACGACTATG pLKO_005 991 CDS 100% 10.800 7.560 N GALK1 n/a
10 TRCN0000010060 GTACAACTGGAAGAGCTAGAG pLKO.1 828 CDS 100% 4.050 2.835 N GALK1 n/a
11 TRCN0000422994 AGGGACCTGGTGAGCAAAGAG pLKO_005 855 CDS 100% 1.650 1.155 N GALK1 n/a
12 TRCN0000199508 GCTCTGGAGCTCATGACGGTG pLKO.1 222 CDS 100% 0.000 0.000 N GALK1 n/a
13 TRCN0000010057 GGGCCAACTATGTCAAGGGAG pLKO.1 373 CDS 100% 0.720 0.432 N GALK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000154.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000465276 GATCAGAGAATTTTGGATAAAAAA pLX_317 25.4% 99.9% 100% V5 189G>A n/a
2 ccsbBroadEn_06250 pDONR223 100% 99.8% 99.7% None 189G>A;1123A>G n/a
3 ccsbBroad304_06250 pLX_304 0% 99.8% 99.7% V5 189G>A;1123A>G n/a
4 ccsbBroadEn_14651 pDONR223 0% 99.9% 100% None 189G>A n/a
5 ccsbBroad304_14651 pLX_304 0% 99.9% 100% V5 189G>A n/a
6 TRCN0000479672 ATTGATCGCCACCAACGTAGACCT pLX_317 25.4% 99.9% 100% V5 189G>A n/a
7 TRCN0000488441 CCAAACACAGTAAAAGCTACAGCC pLX_317 25.4% 99.9% 100% V5 (not translated due to prior stop codon) 189G>A n/a
8 TRCN0000491971 TTAACCTATTAGATCGGCCGAGGG pLX_317 24.4% 99.8% 99.7% V5 189G>A;1176_1177insG n/a
Download CSV