Transcript: Human NM_000769.4

Homo sapiens cytochrome P450 family 2 subfamily C member 19 (CYP2C19), mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
CYP2C19 (1557)
Length:
4131
CDS:
26..1498

Additional Resources:

NCBI RefSeq record:
NM_000769.4
NBCI Gene record:
CYP2C19 (1557)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000769.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417743 TTCCCACTATCATTGATTATT pLKO_005 681 CDS 100% 15.000 12.000 N CYP2C19 n/a
2 TRCN0000064061 CCATATTAACTTCCCTCACTT pLKO.1 1182 CDS 100% 4.950 3.465 N CYP2C19 n/a
3 TRCN0000415775 GATATTAAGGATGTCAGCAAA pLKO_005 161 CDS 100% 4.950 3.465 N CYP2C19 n/a
4 TRCN0000064060 CCTCGTCACTTTCTGGATGAA pLKO.1 1250 CDS 100% 4.950 2.970 N CYP2C19 n/a
5 TRCN0000064059 CCAGAGATACATCGACCTCAT pLKO.1 1090 CDS 100% 4.050 2.430 N CYP2C19 n/a
6 TRCN0000426310 CTATCAGCTGTGCTTCATTCC pLKO_005 1471 CDS 100% 4.050 2.430 N CYP2C19 n/a
7 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 2279 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
8 TRCN0000064058 CCCTGTGTTCACTCTGTATTT pLKO.1 211 CDS 100% 13.200 6.600 Y CYP2C19 n/a
9 TRCN0000064062 CCTCTCCCAGTGATTGGAAAT pLKO.1 128 CDS 100% 10.800 5.400 Y CYP2C19 n/a
10 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 2823 3UTR 100% 4.950 2.475 Y LOC387873 n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2387 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000064105 CCAGAGATGTTTGACCCTCAT pLKO.1 1235 CDS 100% 4.050 2.025 Y CYP2C9 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2387 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000769.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00408 pDONR223 100% 94.8% 91.4% None (many diffs) n/a
2 ccsbBroad304_00408 pLX_304 0% 94.8% 91.4% V5 (many diffs) n/a
3 TRCN0000469884 CCCTTCGTGCCAACCAGCCCTGGA pLX_317 28.5% 94.8% 91.4% V5 (many diffs) n/a
4 ccsbBroadEn_00409 pDONR223 100% 87.5% 80.8% None (many diffs) n/a
5 ccsbBroad304_00409 pLX_304 0% 87.5% 80.8% V5 (many diffs) n/a
6 TRCN0000480849 TTGTGTCTTGCGGCTCGGGATGGG pLX_317 26.8% 87.5% 80.8% V5 (many diffs) n/a
7 ccsbBroadEn_10763 pDONR223 100% 31.7% 30.2% None (many diffs) n/a
8 ccsbBroad304_10763 pLX_304 0% 31.7% 30.2% V5 (many diffs) n/a
9 TRCN0000475303 TGCAACCTTACTCCTTTTATACCA pLX_317 67.3% 31.7% 30.2% V5 (many diffs) n/a
Download CSV