Transcript: Human NM_000848.4

Homo sapiens glutathione S-transferase mu 2 (GSTM2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
GSTM2 (2946)
Length:
1166
CDS:
60..716

Additional Resources:

NCBI RefSeq record:
NM_000848.4
NBCI Gene record:
GSTM2 (2946)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000848.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154400 GAGCAGATTCGCGAAGACATT pLKO.1 336 CDS 100% 4.950 6.930 N GSTM2 n/a
2 TRCN0000155633 CCAGTTTATGGACAGCCGTAT pLKO.1 365 CDS 100% 4.050 5.670 N GSTM2 n/a
3 TRCN0000153813 CCTTTGTGGATTTCATCGCTT pLKO.1 520 CDS 100% 2.640 1.848 N GSTM2 n/a
4 TRCN0000154338 CCCAAGACCTGTGTTCACAAA pLKO.1 671 CDS 100% 4.950 2.970 N GSTM2 n/a
5 TRCN0000156133 CCCTACTTGATTGATGGGACT pLKO.1 240 CDS 100% 2.160 1.296 N GSTM2 n/a
6 TRCN0000083698 CGTTCCTTTCTCCTGTTTATT pLKO.1 816 3UTR 100% 15.000 7.500 Y GSTM1 n/a
7 TRCN0000148357 CGTTCCTTTCTCCTGTTTATT pLKO.1 816 3UTR 100% 15.000 7.500 Y GSTM4 n/a
8 TRCN0000151859 CGTTCCTTTCTCCTGTTTATT pLKO.1 816 3UTR 100% 15.000 7.500 Y GSTM2 n/a
9 TRCN0000280824 CGTTCCTTTCTCCTGTTTATT pLKO_005 816 3UTR 100% 15.000 7.500 Y GSTM4 n/a
10 TRCN0000414415 GTGGTTGTGTCTGCTTTAAAG pLKO_005 999 3UTR 100% 13.200 6.600 Y GSTM1 n/a
11 TRCN0000252919 AGATCACCTTTGTGGATTTCA pLKO_005 514 CDS 100% 5.625 2.813 Y Gstm7 n/a
12 TRCN0000154339 CCTCGTTCCTTTCTCCTGTTT pLKO.1 813 3UTR 100% 4.950 2.475 Y GSTM2 n/a
13 TRCN0000154453 GCTGAAGCTCTACTCACAGTT pLKO.1 461 CDS 100% 4.950 2.475 Y GSTM2 n/a
14 TRCN0000154925 GAAGGACTTCATCTCCCGATT pLKO.1 602 CDS 100% 4.050 2.025 Y GSTM2 n/a
15 TRCN0000147236 GAATACACAGACTCAAGCTAT pLKO.1 123 CDS 100% 4.950 2.475 Y GSTM5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000848.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06332 pDONR223 100% 99.8% 99.5% None 443T>C n/a
2 ccsbBroad304_06332 pLX_304 0% 99.8% 99.5% V5 443T>C n/a
3 ccsbBroadEn_13866 pDONR223 100% 88.3% 81.1% None (many diffs) n/a
4 TRCN0000465604 TAACCACCCTTTTATTTACAACGA pLX_317 59.4% 88.3% 81.1% V5 (many diffs) n/a
5 ccsbBroadEn_06334 pDONR223 100% 87.7% 81.6% None (many diffs) n/a
6 ccsbBroad304_06334 pLX_304 0% 87.7% 81.6% V5 (many diffs) n/a
7 TRCN0000471453 CAGTGATATCGATAATGCGTACCT pLX_317 63.9% 87.7% 81.6% V5 (many diffs) n/a
8 ccsbBroadEn_00702 pDONR223 100% 76.4% 71.1% None (many diffs) n/a
9 ccsbBroad304_00702 pLX_304 0% 76.4% 71.1% V5 (many diffs) n/a
10 TRCN0000469779 ATATGCGTGTAAAATATCACAGCA pLX_317 88% 76.4% 71.1% V5 (many diffs) n/a
Download CSV