Transcript: Human NM_001000.4

Homo sapiens ribosomal protein L39 (RPL39), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
RPL39 (6170)
Length:
390
CDS:
55..210

Additional Resources:

NCBI RefSeq record:
NM_001000.4
NBCI Gene record:
RPL39 (6170)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001000.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000344859 TCACAAGACTTTCAGGATTAA pLKO_005 63 CDS 100% 13.200 6.600 Y RPL39 n/a
2 TRCN0000424956 AGCGATTCCTGGCCAAGAAAC pLKO_005 83 CDS 100% 10.800 5.400 Y Rpl39 n/a
3 TRCN0000117635 CGATTCCTGGCCAAGAAACAA pLKO.1 85 CDS 100% 5.625 2.813 Y RPL39 n/a
4 TRCN0000333551 CGATTCCTGGCCAAGAAACAA pLKO_005 85 CDS 100% 5.625 2.813 Y RPL39 n/a
5 TRCN0000117636 GAAGAACCAAGCTGGGTCTAT pLKO.1 188 CDS 100% 4.950 2.475 Y RPL39 n/a
6 TRCN0000333490 GAAGAACCAAGCTGGGTCTAT pLKO_005 188 CDS 100% 4.950 2.475 Y RPL39 n/a
7 TRCN0000117632 GCACATGAGATGGCACACATA pLKO.1 217 3UTR 100% 4.950 2.475 Y RPL39 n/a
8 TRCN0000333552 GCACATGAGATGGCACACATA pLKO_005 217 3UTR 100% 4.950 2.475 Y RPL39 n/a
9 TRCN0000117634 AGAAGAACCAAGCTGGGTCTA pLKO.1 187 CDS 100% 4.050 2.025 Y RPL39 n/a
10 TRCN0000117633 GAGACATTGGAGAAGAACCAA pLKO.1 177 CDS 100% 3.000 1.500 Y RPL39 n/a
11 TRCN0000117652 GCACACATATTTATGCTGTAT pLKO.1 229 3UTR 100% 4.950 2.475 Y RPL39L n/a
12 TRCN0000333154 GCACACATATTTATGCTGTAT pLKO_005 229 3UTR 100% 4.950 2.475 Y RPL39L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001000.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01440 pDONR223 95.9% 100% 100% None n/a
2 ccsbBroad304_01440 pLX_304 0% 100% 100% V5 (not translated due to prior stop codon) n/a
3 ccsbBroadEn_04718 pDONR223 100% 94.7% 92.1% None (many diffs) n/a
4 ccsbBroad304_04718 pLX_304 0% 94.7% 92.1% V5 (many diffs) n/a
5 TRCN0000471064 TAACGGACTGCAAGGTTGAAGAAC pLX_317 100% 94.7% 92.1% V5 (many diffs) n/a
Download CSV