Transcript: Human NM_001007233.2

Homo sapiens ERCC excision repair 8, CSA ubiquitin ligase complex subunit (ERCC8), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
ERCC8 (1161)
Length:
2262
CDS:
463..1479

Additional Resources:

NCBI RefSeq record:
NM_001007233.2
NBCI Gene record:
ERCC8 (1161)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001007233.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000003723 GCGCTAATGCTTGAACTCTTT pLKO.1 2121 3UTR 100% 4.950 6.930 N ERCC8 n/a
2 TRCN0000342530 GCGCTAATGCTTGAACTCTTT pLKO_005 2121 3UTR 100% 4.950 6.930 N ERCC8 n/a
3 TRCN0000003721 GATGGTGTGATTGTACTTTAT pLKO.1 481 CDS 100% 13.200 9.240 N ERCC8 n/a
4 TRCN0000342528 GATGGTGTGATTGTACTTTAT pLKO_005 481 CDS 100% 13.200 9.240 N ERCC8 n/a
5 TRCN0000003722 TGATGATGAGACTACAACAAA pLKO.1 1401 CDS 100% 5.625 3.938 N ERCC8 n/a
6 TRCN0000342471 TGATGATGAGACTACAACAAA pLKO_005 1401 CDS 100% 5.625 3.938 N ERCC8 n/a
7 TRCN0000003720 TGGAATTAACACCCTTGACAT pLKO.1 202 5UTR 100% 4.950 3.465 N ERCC8 n/a
8 TRCN0000342527 TGGAATTAACACCCTTGACAT pLKO_005 202 5UTR 100% 4.950 3.465 N ERCC8 n/a
9 TRCN0000003719 GCAGCAGTGATGAAGAAGGAT pLKO.1 1457 CDS 100% 3.000 1.800 N ERCC8 n/a
10 TRCN0000342472 GCAGCAGTGATGAAGAAGGAT pLKO_005 1457 CDS 100% 3.000 1.800 N ERCC8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001007233.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10735 pDONR223 100% 35.8% 31.9% None (many diffs) n/a
2 ccsbBroad304_10735 pLX_304 0% 35.8% 31.9% V5 (many diffs) n/a
3 TRCN0000470233 TGCAGCCACTTTTTTAGGCACCTT pLX_317 73% 35.8% 31.9% V5 (many diffs) n/a
Download CSV