Transcript: Human NM_001008505.2

Homo sapiens opioid receptor mu 1 (OPRM1), transcript variant MOR-1X, mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
OPRM1 (4988)
Length:
1549
CDS:
135..1475

Additional Resources:

NCBI RefSeq record:
NM_001008505.2
NBCI Gene record:
OPRM1 (4988)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001008505.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000357703 TTATGCCAGTGCTCATCATTA pLKO_005 865 CDS 100% 13.200 10.560 N OPRM1 n/a
2 TRCN0000011783 CGGCCAATACAGTGGATAGAA pLKO.1 1267 CDS 100% 5.625 4.500 N OPRM1 n/a
3 TRCN0000368502 TGATCTCCATAGATTACTATA pLKO_005 568 CDS 100% 13.200 9.240 N OPRM1 n/a
4 TRCN0000011784 CCAGAGTGTGAATTACCTAAT pLKO.1 509 CDS 100% 10.800 7.560 N OPRM1 n/a
5 TRCN0000009275 CGTGTGCTATGGACTGATGAT pLKO.1 887 CDS 100% 4.950 3.465 N OPRM1 n/a
6 TRCN0000011785 GCATTGCTCTAGGTTACACAA pLKO.1 1102 CDS 100% 4.950 3.465 N OPRM1 n/a
7 TRCN0000027844 CTGGTCATGTATGTGATTGTA pLKO.1 402 CDS 100% 5.625 3.938 N Oprm1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001008505.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01122 pDONR223 100% 88.8% 86% None (many diffs) n/a
2 ccsbBroad304_01122 pLX_304 0% 88.8% 86% V5 (many diffs) n/a
3 TRCN0000488117 GCCCGGGTCACCAAGCGACCACCG pLX_317 15.7% 77.9% 75.7% V5 (many diffs) n/a
4 TRCN0000492306 TTGATCTCAAGGTTACTTTAACGC pLX_317 30.6% 77.9% 75.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV