Transcript: Human NM_001008660.3

Homo sapiens phosphatidylinositol binding clathrin assembly protein (PICALM), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
PICALM (8301)
Length:
4008
CDS:
305..2137

Additional Resources:

NCBI RefSeq record:
NM_001008660.3
NBCI Gene record:
PICALM (8301)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001008660.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230158 TGACGCAACCAACCTTAATAT pLKO_005 2046 CDS 100% 15.000 21.000 N PICALM n/a
2 TRCN0000119074 CTACATTTATTAGGCGGTATA pLKO.1 666 CDS 100% 10.800 15.120 N PICALM n/a
3 TRCN0000230157 GGCAATCTTGGCATCGGAAAT pLKO_005 1799 CDS 100% 10.800 15.120 N PICALM n/a
4 TRCN0000119075 CCTAGCAAGTTAGTATCTGAT pLKO.1 1748 CDS 100% 4.950 6.930 N PICALM n/a
5 TRCN0000119076 CGTATCCAAGACAGTATGCAA pLKO.1 367 CDS 100% 3.000 4.200 N PICALM n/a
6 TRCN0000230156 GCACCAGCCATTGACATATTT pLKO_005 1415 CDS 100% 15.000 10.500 N PICALM n/a
7 TRCN0000313326 GCACCAGCCATTGACATATTT pLKO_005 1415 CDS 100% 15.000 10.500 N Picalm n/a
8 TRCN0000230155 GAATTGACAGAGGTGATATAC pLKO_005 1077 CDS 100% 13.200 9.240 N PICALM n/a
9 TRCN0000119072 GCCTTAATGTTGACTTTGAAT pLKO.1 1605 CDS 100% 5.625 3.938 N PICALM n/a
10 TRCN0000119073 CCTCCACAAATGGGAAGTGTT pLKO.1 2018 CDS 100% 4.950 3.465 N PICALM n/a
11 TRCN0000113186 GCAGCATACAATGAAGGAATT pLKO.1 929 CDS 100% 0.000 0.000 N Picalm n/a
12 TRCN0000218840 TGCCATGTTATGATCATATAC pLKO_005 3194 3UTR 100% 13.200 7.920 N PICALM n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001008660.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01884 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01884 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480673 ATGGTAAACCCTCTATTCGATGTC pLX_317 18.6% 100% 100% V5 n/a
Download CSV