Transcript: Mouse NM_001013441.2

Mus musculus RIC8 guanine nucleotide exchange factor B (Ric8b), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Ric8b (237422)
Length:
4897
CDS:
130..1692

Additional Resources:

NCBI RefSeq record:
NM_001013441.2
NBCI Gene record:
Ric8b (237422)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001013441.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000440998 ACCGAAGAGCTGCACAGTAAT pLKO_005 949 CDS 100% 13.200 18.480 N Ric8b n/a
2 TRCN0000445620 CACGAGTCAGACGATTCTTTG pLKO_005 424 CDS 100% 10.800 15.120 N Ric8b n/a
3 TRCN0000420175 CATTAACTGGTTTACTCATTG pLKO_005 1806 3UTR 100% 10.800 15.120 N Ric8b n/a
4 TRCN0000006465 CGACAAGCATAGGGCTACTTT pLKO.1 207 CDS 100% 5.625 7.875 N RIC8B n/a
5 TRCN0000189987 GCAGTCTTGTTGCCGAAGATT pLKO.1 1993 3UTR 100% 5.625 7.875 N Ric8b n/a
6 TRCN0000202235 CGTGCCTATTTATCCCTCGTT pLKO.1 2357 3UTR 100% 2.640 2.112 N Ric8b n/a
7 TRCN0000192421 CCTTCGCCATTGTTTACTAAT pLKO.1 906 CDS 100% 13.200 9.240 N Ric8b n/a
8 TRCN0000436180 GCTTAAACCAATGGGACTAAA pLKO_005 1590 CDS 100% 13.200 9.240 N Ric8b n/a
9 TRCN0000414912 GTCGGCTCAACCGTGAGAAAT pLKO_005 1330 CDS 100% 13.200 9.240 N Ric8b n/a
10 TRCN0000413644 GCAACATTGAGGCATTCATAC pLKO_005 1865 3UTR 100% 10.800 7.560 N Ric8b n/a
11 TRCN0000200949 CCCAGTTATTGTGGAATCATT pLKO.1 462 CDS 100% 5.625 3.938 N Ric8b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001013441.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12180 pDONR223 100% 79.8% 81% None (many diffs) n/a
2 ccsbBroad304_12180 pLX_304 0% 79.8% 81% V5 (many diffs) n/a
3 TRCN0000477167 ACGTCCTACCCTAAGCCCTGGAGT pLX_317 19.1% 79.8% 81% V5 (many diffs) n/a
Download CSV