Transcript: Human NM_001031628.2

Homo sapiens small cell adhesion glycoprotein (SMAGP), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
SMAGP (57228)
Length:
1875
CDS:
199..492

Additional Resources:

NCBI RefSeq record:
NM_001031628.2
NBCI Gene record:
SMAGP (57228)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001031628.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000141240 CGCTAACACGTTGACTGCTTA pLKO.1 531 3UTR 100% 4.950 6.930 N SMAGP n/a
2 TRCN0000285523 CGCTAACACGTTGACTGCTTA pLKO_005 531 3UTR 100% 4.950 6.930 N SMAGP n/a
3 TRCN0000276303 CAGCGAGAAAGAGGAATATTT pLKO_005 465 CDS 100% 15.000 10.500 N SMAGP n/a
4 TRCN0000168598 GCAGCGAGAAAGAGGAATATT pLKO.1 464 CDS 100% 15.000 10.500 N SMAGP n/a
5 TRCN0000276302 GCACTCATTGCAGTTGTTATC pLKO_005 301 CDS 100% 10.800 7.560 N SMAGP n/a
6 TRCN0000167134 CTGCTTATTATGGGAAAGTTT pLKO.1 545 3UTR 100% 5.625 3.938 N SMAGP n/a
7 TRCN0000122279 CCAGTGGAGATACTGTCCATA pLKO.1 875 3UTR 100% 4.950 3.465 N SMAGP n/a
8 TRCN0000143552 GCATTGATTGATGTGGGCAAA pLKO.1 585 3UTR 100% 4.050 2.835 N SMAGP n/a
9 TRCN0000276304 GCATTGATTGATGTGGGCAAA pLKO_005 585 3UTR 100% 4.050 2.835 N SMAGP n/a
10 TRCN0000144561 GACATGGAGAAAGCTGTTTAT pLKO.1 665 3UTR 100% 13.200 7.920 N SMAGP n/a
11 TRCN0000276305 GACATGGAGAAAGCTGTTTAT pLKO_005 665 3UTR 100% 13.200 7.920 N SMAGP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001031628.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03810 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03810 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466242 TAGCCGCAGAATAACATTGTTGTC pLX_317 100% 100% 100% V5 n/a
4 ccsbBroadEn_12339 pDONR223 100% 25% 3% None 1_205del;291_292ins52 n/a
5 ccsbBroad304_12339 pLX_304 0% 25% 3% V5 1_205del;291_292ins52 n/a
6 TRCN0000472200 AATTGTACGTGGGCCGATGGTCAC pLX_317 100% 25% 3% V5 1_205del;291_292ins52 n/a
Download CSV