Transcript: Human NM_001032394.2

Homo sapiens adhesion G protein-coupled receptor G6 (ADGRG6), transcript variant a2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
ADGRG6 (57211)
Length:
6896
CDS:
412..3993

Additional Resources:

NCBI RefSeq record:
NM_001032394.2
NBCI Gene record:
ADGRG6 (57211)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001032394.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000273861 ACACGGTTTATGTCGTTAATA pLKO_005 1664 CDS 100% 15.000 21.000 N ADGRG6 n/a
2 TRCN0000273811 ACTTAACCTCAGCCAATATTA pLKO_005 2126 CDS 100% 15.000 21.000 N ADGRG6 n/a
3 TRCN0000011562 CCTATCTTACATCCAAATCTA pLKO.1 3839 CDS 100% 5.625 7.875 N ADGRG6 n/a
4 TRCN0000273865 CCTATCTTACATCCAAATCTA pLKO_005 3839 CDS 100% 5.625 7.875 N ADGRG6 n/a
5 TRCN0000011558 GCTCATTCAGACAACTTCTAT pLKO.1 4058 3UTR 100% 5.625 4.500 N ADGRG6 n/a
6 TRCN0000273863 GCTCATTCAGACAACTTCTAT pLKO_005 4058 3UTR 100% 5.625 4.500 N ADGRG6 n/a
7 TRCN0000011560 CCAAGCAATAATGAATCGTAT pLKO.1 2428 CDS 100% 4.950 3.465 N ADGRG6 n/a
8 TRCN0000011561 CCCTTCTAGTTTACAATGCTA pLKO.1 1766 CDS 100% 3.000 2.100 N ADGRG6 n/a
9 TRCN0000011559 CCTCACTTTCATCAGCTATAT pLKO.1 2916 CDS 100% 13.200 7.920 N ADGRG6 n/a
10 TRCN0000273809 CCTCACTTTCATCAGCTATAT pLKO_005 2916 CDS 100% 13.200 7.920 N ADGRG6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001032394.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488564 TCGAATCTTCTCCGCTGAAATTAC pLX_317 9.2% 95.1% 95.5% V5 (not translated due to prior stop codon) 3488_3533del;3579_3580ins133 n/a
2 TRCN0000488233 CTTTCCTGATTTACCATATGGCAG pLX_317 9.1% 95.1% 95.4% V5 3488_3533del;3579_3580ins134 n/a
3 ccsbBroadEn_14228 pDONR223 100% 95% 34.7% None (many diffs) n/a
4 ccsbBroad304_14228 pLX_304 0% 95% 34.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV