Transcript: Mouse NM_001033254.3

Mus musculus p21 protein (Cdc42/Rac)-activated kinase 6 (Pak6), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Pak6 (214230)
Length:
4137
CDS:
643..2691

Additional Resources:

NCBI RefSeq record:
NM_001033254.3
NBCI Gene record:
Pak6 (214230)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033254.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000360860 CCGAGATATCAAGAGTGATTC pLKO_005 2217 CDS 100% 10.800 15.120 N Pak6 n/a
2 TRCN0000360784 ACGCAGGGAGCTGCTCTTTAA pLKO_005 1977 CDS 100% 13.200 9.240 N Pak6 n/a
3 TRCN0000360786 CCCAAGCTAAAGAACTCTTAC pLKO_005 2500 CDS 100% 10.800 7.560 N Pak6 n/a
4 TRCN0000360785 GTACGCTACTGAGGTGGATAT pLKO_005 2376 CDS 100% 10.800 7.560 N Pak6 n/a
5 TRCN0000025187 CTGGACAGCTACGTGAAGATT pLKO.1 1864 CDS 100% 5.625 3.938 N Pak6 n/a
6 TRCN0000025184 GCTCAACGACATTCAGAAGTT pLKO.1 897 CDS 100% 4.950 3.465 N Pak6 n/a
7 TRCN0000025188 CAATGGCAGAACATTCTGGAT pLKO.1 757 CDS 100% 2.640 1.848 N Pak6 n/a
8 TRCN0000025186 CCTAGCCCTAAGAACCAGGAA pLKO.1 1384 CDS 100% 2.640 1.848 N Pak6 n/a
9 TRCN0000025185 CTCACAGACATCATCTCCCAA pLKO.1 2110 CDS 100% 2.640 1.848 N Pak6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033254.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03756 pDONR223 100% 88.7% 92.5% None (many diffs) n/a
2 ccsbBroad304_03756 pLX_304 0% 88.7% 92.5% V5 (many diffs) n/a
3 TRCN0000480942 ACTAGACGAACTCCGTGGCATTGG pLX_317 18.7% 88.7% 92.5% V5 (many diffs) n/a
4 ccsbBroadEn_15114 pDONR223 0% 88.7% 92.5% None (many diffs) n/a
5 ccsbBroad304_15114 pLX_304 0% 88.7% 92.5% V5 (many diffs) n/a
6 TRCN0000474094 CACGGGTCGCCTACTCATACCTGA pLX_317 22.2% 88.7% 92.5% V5 (many diffs) n/a
7 TRCN0000489778 TGGGGATCTGCTTCATCGTGAGCG pLX_317 17.4% 88.7% 92.5% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000488099 AGATGGCCCCTTTGTAGTATGAAC pLX_317 16.6% 88.6% 92.3% V5 (many diffs) n/a
Download CSV