Transcript: Mouse NM_001039509.1

Mus musculus paroxysmal nonkinesiogenic dyskinesia (Pnkd), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Mus musculus (mouse)
Gene:
Pnkd (56695)
Length:
2956
CDS:
38..1195

Additional Resources:

NCBI RefSeq record:
NM_001039509.1
NBCI Gene record:
Pnkd (56695)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001039509.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101681 GCTAGAATACATTCCCAGAAA pLKO.1 214 CDS 100% 4.950 3.960 N Pnkd n/a
2 TRCN0000271801 CTCTGGAGCCACAGCTAACAA pLKO_005 112 CDS 100% 5.625 3.938 N Pnkd n/a
3 TRCN0000101684 CCACAGCTCACCAGAATGCAA pLKO.1 166 CDS 100% 3.000 2.100 N Pnkd n/a
4 TRCN0000062754 CCGCCTCTTCAATGGAGTGAA pLKO.1 376 CDS 100% 4.950 2.970 N PNKD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001039509.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07971 pDONR223 100% 90.3% 95.3% None (many diffs) n/a
2 ccsbBroad304_07971 pLX_304 0% 90.3% 95.3% V5 (many diffs) n/a
3 TRCN0000475264 TTTCCAGAGACGCCTGCCATGAGC pLX_317 9% 90.3% 95.3% V5 (many diffs) n/a
4 ccsbBroadEn_02891 pDONR223 100% 79.5% 75.9% None (many diffs) n/a
5 ccsbBroad304_02891 pLX_304 0% 79.5% 75.9% V5 (many diffs) n/a
6 TRCN0000474944 TCAATTTTGAGAGTCTCCACTGTC pLX_317 47.6% 79.5% 75.9% V5 (many diffs) n/a
Download CSV