Transcript: Human NM_001042452.2

Homo sapiens serine/threonine kinase 26 (STK26), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
STK26 (51765)
Length:
2878
CDS:
30..1094

Additional Resources:

NCBI RefSeq record:
NM_001042452.2
NBCI Gene record:
STK26 (51765)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001042452.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195233 CAACTCATGTTATGGGTTAAA pLKO.1 2668 3UTR 100% 13.200 18.480 N STK26 n/a
2 TRCN0000003193 CCAGATTGCTACCATGCTAAA pLKO.1 386 CDS 100% 10.800 15.120 N STK26 n/a
3 TRCN0000320666 CCAGATTGCTACCATGCTAAA pLKO_005 386 CDS 100% 10.800 15.120 N STK26 n/a
4 TRCN0000003191 CCTCTTGGTGTATAGTATTTA pLKO.1 1724 3UTR 100% 15.000 10.500 N STK26 n/a
5 TRCN0000320745 CCTCTTGGTGTATAGTATTTA pLKO_005 1724 3UTR 100% 15.000 10.500 N STK26 n/a
6 TRCN0000003194 GATCCAAAGAAAGTACAGAAT pLKO.1 843 CDS 100% 4.950 3.465 N STK26 n/a
7 TRCN0000320742 GATCCAAAGAAAGTACAGAAT pLKO_005 843 CDS 100% 4.950 3.465 N STK26 n/a
8 TRCN0000196861 GCTCCTGAAGTTATTCAACAG pLKO.1 588 CDS 100% 4.050 2.835 N STK26 n/a
9 TRCN0000003195 CTTAAACAGCAGGACGAGAAT pLKO.1 933 CDS 100% 4.950 2.970 N STK26 n/a
10 TRCN0000320668 CTTAAACAGCAGGACGAGAAT pLKO_005 933 CDS 100% 4.950 2.970 N STK26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001042452.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488375 TTCTCACGTAATATCCGCCAGCGC pLX_317 28.3% 100% 100% V5 (not translated due to prior stop codon) n/a
2 TRCN0000489362 TAACTTCACCGACTGAACCTGCCG pLX_317 23.4% 85% 85% V5 (not translated due to prior stop codon) 597_598ins186 n/a
3 TRCN0000488583 CCTCGCAATGTAAACGGTGATGAG pLX_317 22.6% 85% 84.8% V5 597_598ins186;1062_1063insG n/a
4 ccsbBroadEn_12016 pDONR223 100% 38.7% 32.4% None 335_785del;863_1062del n/a
5 ccsbBroad304_12016 pLX_304 0% 38.7% 32.4% V5 335_785del;863_1062del n/a
6 TRCN0000473372 CTCCGCCTCCTCGTCGTGTAGAGA pLX_317 100% 38.7% 32.4% V5 335_785del;863_1062del n/a
7 ccsbBroadEn_15074 pDONR223 0% 38.7% 32.4% None 335_785del;863_1062del n/a
8 ccsbBroad304_15074 pLX_304 0% 38.7% 32.4% V5 335_785del;863_1062del n/a
9 TRCN0000474098 CTGAGGCAGCGTCGGCTATTCGCA pLX_317 90.9% 38.7% 32.4% V5 335_785del;863_1062del n/a
Download CSV