Transcript: Mouse NM_001045530.2

Mus musculus cyclin J-like (Ccnjl), mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Ccnjl (380694)
Length:
2709
CDS:
262..1425

Additional Resources:

NCBI RefSeq record:
NM_001045530.2
NBCI Gene record:
Ccnjl (380694)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001045530.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251364 GGAAGACCGCGTGCCTAAATT pLKO_005 555 CDS 100% 15.000 21.000 N Ccnjl n/a
2 TRCN0000251363 GTGCAATATGTTATGACTATG pLKO_005 2515 3UTR 100% 10.800 8.640 N Ccnjl n/a
3 TRCN0000251362 TTACCCTGCAAGATCATATAT pLKO_005 830 CDS 100% 15.000 10.500 N Ccnjl n/a
4 TRCN0000251361 GAGCATCTCAGCACGTGTATC pLKO_005 967 CDS 100% 10.800 7.560 N Ccnjl n/a
5 TRCN0000251365 GTCGATTCTTTGTAGACATTC pLKO_005 374 CDS 100% 10.800 7.560 N Ccnjl n/a
6 TRCN0000158129 CTGCATCCCTTAGCATGCATA pLKO.1 1304 CDS 100% 0.495 0.347 N CCNJL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001045530.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12574 pDONR223 100% 75% 64.5% None (many diffs) n/a
2 ccsbBroad304_12574 pLX_304 0% 75% 64.5% V5 (many diffs) n/a
3 TRCN0000470812 GGCTGATGGTCTAGTTTCTTTACA pLX_317 35.9% 75% 64.5% V5 (many diffs) n/a
Download CSV