Transcript: Mouse NM_001077406.1

Mus musculus neuropilin 2 (Nrp2), transcript variant 5, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Nrp2 (18187)
Length:
4711
CDS:
889..3609

Additional Resources:

NCBI RefSeq record:
NM_001077406.1
NBCI Gene record:
Nrp2 (18187)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001077406.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000028976 CCGGATTGCTAATGAACAGAT pLKO.1 1746 CDS 100% 4.950 3.960 N Nrp2 n/a
2 TRCN0000028978 CCAGAGAAGTATCCACACAAT pLKO.1 1384 CDS 100% 4.950 3.465 N Nrp2 n/a
3 TRCN0000028975 CCGTGAAGAGTGAAGAGACTA pLKO.1 2708 CDS 100% 4.950 3.465 N Nrp2 n/a
4 TRCN0000028974 CCTCACTTTGAAATCGAGAAA pLKO.1 1108 CDS 100% 4.950 2.970 N Nrp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001077406.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02025 pDONR223 100% 81.2% 83.7% None (many diffs) n/a
2 ccsbBroad304_02025 pLX_304 0% 81.2% 83.7% V5 (many diffs) n/a
3 TRCN0000470036 AGGTAGGCTCTCAACGCTGCCTCA pLX_317 16.7% 81.2% 83.7% V5 (many diffs) n/a
4 ccsbBroadEn_11311 pDONR223 100% 9.7% 8.7% None (many diffs) n/a
5 ccsbBroad304_11311 pLX_304 0% 9.7% 8.7% V5 (many diffs) n/a
6 TRCN0000469807 CGAGGCGTACGCATAGCAACATTA pLX_317 100% 9.7% 8.7% V5 (many diffs) n/a
Download CSV