Transcript: Mouse NM_001114663.1

Mus musculus phospholipase C-like 1 (Plcl1), mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Plcl1 (227120)
Length:
6555
CDS:
443..3733

Additional Resources:

NCBI RefSeq record:
NM_001114663.1
NBCI Gene record:
Plcl1 (227120)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001114663.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234161 TAGTAAGCAACCGCTTGATTT pLKO_005 1117 CDS 100% 13.200 18.480 N Plcl1 n/a
2 TRCN0000218943 TTTCGTACTTCAGCGCAAATA pLKO_005 2556 CDS 100% 13.200 18.480 N Plcl1 n/a
3 TRCN0000027725 CGCTTGGAATATTACGGTATT pLKO.1 3526 CDS 100% 10.800 15.120 N Plcl1 n/a
4 TRCN0000027719 CCTTACGAGAAGCCATAGATA pLKO.1 3123 CDS 100% 5.625 7.875 N Plcl1 n/a
5 TRCN0000234162 ACCCTTATCTCACTACTATAT pLKO_005 1651 CDS 100% 13.200 10.560 N Plcl1 n/a
6 TRCN0000027687 CCTTTGTAATAGGAACAACAT pLKO.1 1810 CDS 100% 4.950 3.960 N Plcl1 n/a
7 TRCN0000234164 ACTCTAAGCTGTGAGTATATA pLKO_005 3931 3UTR 100% 15.000 10.500 N Plcl1 n/a
8 TRCN0000027754 CCAGAGGACTTCGTGAATTAT pLKO.1 2327 CDS 100% 15.000 10.500 N Plcl1 n/a
9 TRCN0000234163 CTTACGAGAAGCCATAGATAT pLKO_005 3124 CDS 100% 13.200 9.240 N Plcl1 n/a
10 TRCN0000027702 CCCTACTCTGAAGGAATCTAA pLKO.1 1261 CDS 100% 5.625 3.938 N Plcl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001114663.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13920 pDONR223 100% 80.1% .7% None (many diffs) n/a
2 ccsbBroad304_13920 pLX_304 0% 80.1% .7% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000477515 CGGGTATATCCCGATTCTAAAAAC pLX_317 14.2% 80.1% .7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV