Transcript: Human NM_001130917.3

Homo sapiens leukocyte immunoglobulin like receptor A2 (LILRA2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
LILRA2 (11027)
Length:
4482
CDS:
90..1541

Additional Resources:

NCBI RefSeq record:
NM_001130917.3
NBCI Gene record:
LILRA2 (11027)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001130917.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056843 GCTGAGGAGTACCATCTATAT pLKO.1 252 CDS 100% 13.200 18.480 N LILRA2 n/a
2 TRCN0000056844 CCACAATCACTCATCAGAGTA pLKO.1 392 CDS 100% 4.950 6.930 N LILRA2 n/a
3 TRCN0000438058 CCTGGGTTAGACGGATACAAG pLKO_005 292 CDS 100% 4.950 6.930 N LILRA2 n/a
4 TRCN0000056845 GCGGTATCACTGTCAGTACTA pLKO.1 368 CDS 100% 4.950 6.930 N LILRA2 n/a
5 TRCN0000438402 CAGATGCTACAGCTCACTCAG pLKO_005 1268 CDS 100% 4.050 2.835 N LILRA2 n/a
6 TRCN0000441476 CCAGAGAAGCCTACAAGATGC pLKO_005 1508 CDS 100% 4.050 2.835 N LILRA2 n/a
7 TRCN0000434671 ATCACAGGACAGTTCTATGAC pLKO_005 1035 CDS 100% 4.950 2.970 N LILRA2 n/a
8 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2536 3UTR 100% 4.950 2.475 Y ERAP2 n/a
9 TRCN0000056846 CCAGGATTACACAGTGGAGAA pLKO.1 1415 CDS 100% 4.050 2.025 Y LILRA2 n/a
10 TRCN0000056877 GTTCTGTATAAGGAGGGAGAA pLKO.1 849 CDS 100% 4.050 2.025 Y LILRA1 n/a
11 TRCN0000056876 CCACACTTTCCTTCTGACCAA pLKO.1 1139 CDS 100% 2.640 1.320 Y LILRA1 n/a
12 TRCN0000056847 CGACAGATTTGTTCTGTATAA pLKO.1 839 CDS 100% 1.320 0.660 Y LILRA2 n/a
13 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2537 3UTR 100% 13.200 6.600 Y LIAS n/a
14 TRCN0000056874 GAGAAGATGAACACCCACAAT pLKO.1 562 CDS 100% 4.950 2.475 Y LILRA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001130917.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07730 pDONR223 100% 96.4% 96% None 404C>T;1256_1306del n/a
2 ccsbBroad304_07730 pLX_304 0% 96.4% 96% V5 404C>T;1256_1306del n/a
3 ccsbBroadEn_02599 pDONR223 100% 87.5% 79.1% None (many diffs) n/a
4 ccsbBroad304_02599 pLX_304 0% 87.5% 79.1% V5 (many diffs) n/a
5 TRCN0000476912 AATATTGCGCGCAACCGAGCATCT pLX_317 19.2% 87.5% 79.1% V5 (many diffs) n/a
6 ccsbBroadEn_07729 pDONR223 100% 81.6% 73.4% None (many diffs) n/a
7 ccsbBroad304_07729 pLX_304 0% 81.6% 73.4% V5 (many diffs) n/a
8 TRCN0000478306 AGCCAAGCTCAGGCTTTGGACACT pLX_317 25.7% 81.6% 73.4% V5 (many diffs) n/a
9 ccsbBroadEn_07695 pDONR223 100% 64.7% 56.4% None (many diffs) n/a
10 ccsbBroad304_07695 pLX_304 0% 64.7% 56.4% V5 (many diffs) n/a
11 TRCN0000477615 ACCTCCGGAGCACCCTCCTCATAA pLX_317 20.9% 64.7% 56.4% V5 (many diffs) n/a
Download CSV