Transcript: Human NM_001135196.2

Homo sapiens chromosome 10 open reading frame 71 (C10orf71), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
C10orf71 (118461)
Length:
5258
CDS:
312..4619

Additional Resources:

NCBI RefSeq record:
NM_001135196.2
NBCI Gene record:
C10orf71 (118461)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001135196.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146858 CATCAACACATACTTAGCCTT pLKO.1 4732 3UTR 100% 2.640 3.696 N C10orf71 n/a
2 TRCN0000146429 CTCACTTGTAAGCTCCTTGAT pLKO.1 5021 3UTR 100% 4.950 3.960 N C10orf71 n/a
3 TRCN0000146510 CTAGAGGTAAGGTTGATGGAA pLKO.1 1891 CDS 100% 3.000 2.400 N C10orf71 n/a
4 TRCN0000434528 CCAAAGTATCAACACTAATTA pLKO_005 733 CDS 100% 15.000 10.500 N C10orf71 n/a
5 TRCN0000127607 CCAGGTTTCAAGAGTCACTTT pLKO.1 3396 CDS 100% 4.950 3.465 N C10orf71 n/a
6 TRCN0000129559 CGAGACAGCTACAAGTCCAAA pLKO.1 1776 CDS 100% 4.950 3.465 N C10orf71 n/a
7 TRCN0000146777 CAGACAGCTATCTAACTCTTA pLKO.1 2065 CDS 100% 4.950 2.970 N C10orf71 n/a
8 TRCN0000148519 CATAAAGTCCAGAAGGCAGTA pLKO.1 4761 3UTR 100% 4.050 2.430 N C10orf71 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4692 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001135196.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13068 pDONR223 100% 49.2% 47.9% None (many diffs) n/a
2 ccsbBroad304_13068 pLX_304 0% 49.2% 47.9% V5 (many diffs) n/a
3 TRCN0000471401 CTCGCCAAACAATTCTACCCGCGG pLX_317 12.8% 49.2% 47.9% V5 (many diffs) n/a
Download CSV