Transcript: Human NM_001135740.1

Homo sapiens pregnancy up-regulated nonubiquitous CaM kinase (PNCK), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-06-24
Taxon:
Homo sapiens (human)
Gene:
PNCK (139728)
Length:
1522
CDS:
19..1101

Additional Resources:

NCBI RefSeq record:
NM_001135740.1
NBCI Gene record:
PNCK (139728)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001135740.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021571 CATCAGCAGCGTCTACGAGAT pLKO.1 99 CDS 100% 4.050 5.670 N PNCK n/a
2 TRCN0000021572 GATCGCAGTGCTCCGTAGGAT pLKO.1 252 CDS 100% 1.000 1.400 N PNCK n/a
3 TRCN0000315432 CCTTCGACAGGGACATCTTAG pLKO_005 893 CDS 100% 10.800 7.560 N PNCK n/a
4 TRCN0000381077 ACATCTCAGAATCAGCCAAAG pLKO_005 782 CDS 100% 6.000 4.200 N PNCK n/a
5 TRCN0000315431 TTCCTTCCCTTGGATGCTTTC pLKO_005 1144 3UTR 100% 6.000 4.200 N PNCK n/a
6 TRCN0000381892 GCCCTTTGAGGACTCGAAGAT pLKO_005 507 CDS 100% 4.950 3.465 N PNCK n/a
7 TRCN0000199140 CGGAAGAACTTTGCTCGGACA pLKO.1 934 CDS 100% 2.160 1.512 N PNCK n/a
8 TRCN0000021573 CCTCGTGGCCCTCAAGTGCAT pLKO.1 186 CDS 100% 0.000 0.000 N PNCK n/a
9 TRCN0000350552 CCTCGTGGCCCTCAAGTGCAT pLKO_005 186 CDS 100% 0.000 0.000 N PNCK n/a
10 TRCN0000021569 GCTATGAGTTTGACTCTCCTT pLKO.1 752 CDS 100% 2.640 1.584 N PNCK n/a
11 TRCN0000315430 GCTATGAGTTTGACTCTCCTT pLKO_005 752 CDS 100% 2.640 1.584 N PNCK n/a
12 TRCN0000199949 GCGAGCTGTTTGACCGCATCA pLKO.1 356 CDS 100% 1.350 0.810 N PNCK n/a
13 TRCN0000021570 CGAGAGCCCTTCCCACCTCTA pLKO.1 309 CDS 100% 0.000 0.000 N PNCK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001135740.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491589 CTAAACCTTTCCAAATGAGTCACC pLX_317 86% 23.7% 23.6% V5 1_51del;119_120ins87;329_1080del n/a
2 ccsbBroadEn_13199 pDONR223 100% 23.6% 23.6% None 1_51del;119_120ins87;328_1080del n/a
3 ccsbBroad304_13199 pLX_304 0% 23.6% 23.6% V5 1_51del;119_120ins87;328_1080del n/a
4 TRCN0000465807 GCCCCCCATACACAAGTGACTCCA pLX_317 55.3% 23.6% 23.6% V5 1_51del;119_120ins87;328_1080del n/a
5 ccsbBroadEn_15252 pDONR223 0% 23.6% 23.6% None 1_51del;119_120ins87;328_1080del n/a
6 ccsbBroad304_15252 pLX_304 0% 23.6% 23.6% V5 1_51del;119_120ins87;328_1080del n/a
7 TRCN0000471652 TCGAAGAAAGCGAATCCCTTGCAG pLX_317 72.3% 23.6% 23.6% V5 1_51del;119_120ins87;328_1080del n/a
8 TRCN0000488639 GACCAGCTCATGTGGATGCGCCAA pLX_317 69.1% 23.6% 23.6% V5 (not translated due to prior stop codon) 1_51del;119_120ins87;328_1080del n/a
Download CSV