Transcript: Human NM_001142626.3

Homo sapiens thyroid stimulating hormone receptor (TSHR), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-16
Taxon:
Homo sapiens (human)
Gene:
TSHR (7253)
Length:
1144
CDS:
61..885

Additional Resources:

NCBI RefSeq record:
NM_001142626.3
NBCI Gene record:
TSHR (7253)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001142626.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014200 GCCCAATATTTCCAGAATCTA pLKO.1 285 CDS 100% 5.625 7.875 N TSHR n/a
2 TRCN0000014202 GCTGTTTACCTAAACAAGAAT pLKO.1 670 CDS 100% 0.563 0.394 N TSHR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001142626.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01717 pDONR223 100% 92.3% 92.3% None 693_755del n/a
2 ccsbBroad304_01717 pLX_304 0% 92.3% 92.3% V5 693_755del n/a
3 TRCN0000473427 AATACTGGTTAATAGTTTAAAGCG pLX_317 61.8% 92.3% 92.3% V5 693_755del n/a
4 ccsbBroadEn_07104 pDONR223 100% 92% 91.9% None 693_755del;759A>G;805C>A n/a
5 ccsbBroad304_07104 pLX_304 0% 92% 91.9% V5 693_755del;759A>G;805C>A n/a
6 TRCN0000472908 CCGATTATGCCCAACTGTCGGTTT pLX_317 61.8% 92% 91.9% V5 693_755del;759A>G;805C>A n/a
7 TRCN0000487846 GCACAGAACTCCCCGGGAGCTATC pLX_317 11% 34.4% 32.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV